We narrowed to 3 results for: puromycin
-
TypeGuide...3' end of puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance...
-
Gamma-Retroviral Vector Guide
TypeGuide... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance... -
Lentiviral Vector Guide
TypeGuide... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...