Skip to main content

We narrowed to 130 results for: tet on

Showing: 21 - 40 of 130 results
  1. Plasmid Collections

    Type
    Collection
    ...Microbiology Plant Expression Stem Cells Synthetic Biology Tet Inducible Expression Worm Expression Kits Kits are...
  2. Bikard Lab - CRISPR Repression Collection

    Type
    Collection
    ...strain expressing two reporters and dCas9 under a P-tet promoter integrated in the chromosome at phage attachment...allows for quick integration of the aTc-inducible pTet-dCas9 in the attachment site of the phage 186. Detailed...
  3. Mammalian RNAi Tools

    Type
    Collection
    ...that allow for conditional (Cre-lox) or inducible (Tet) expression are available. To find plasmids containing...
  4. E11 Bio PRISM Collection

    Type
    Collection
    ... has also developed a set of Cre-dependent, hSyn-Tet inducible plasmids (Addgene #242782–242799) suitable...
  5. Hot Plasmids - November 2023

    Type
    Blog Post
    ...induced GFP-iPAK4 expressed under promoters like the tet-responsive element (TRE) or the cFos promoter. For...Importantly, even commercial antibodies can be tethered on the viral surface, expanding the range of targetable...
  6. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ... several tetracycline operators. Transcription can be turned on or off depending on what tet transactivator...General expression mRNA Tetracycline response element promoter Inducible with Tetracyline or its derivatives...
  7. Retrovirus Plasmids

    Type
    Collection
    ...IRES-mCherry. Dario Vignali 27995 TtRMPVIR CMV/MSV Tet-regulated expression of shRNA. Expresses rtTA. See...William Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in...
  8. Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior

    Type
    Blog Post
    ...incorporating a Tet-Off system to boost XFP expression. The increased brightness of Tetbow allows this system... proliferating cells. Tetbow optimizes Brainbow for current technologies Tetbow (Sakaguchi et al., 2018...fluorophores RFP (red), YFP (yellow), and membrane-tethered CFP (cyan). Brainbow 1.1 adds OFP (orange) (Livet...Flp recombinase. The XFPs in Flybow are membrane-tethered, making this system useful for visualization of...discriminating neurons within only one field of view. Tetbow can be introduced in vivo either by electroporation...vectors. The Imai lab also developed a version of Tetbow that incorporates chemical tags instead of XFP ...this blog post from the researchers who developed Tetbow. Conclusion Stochastic multicolor cell labeling...
  9. CRISPR 101: Epigenetics and Editing the Epigenome

    Type
    Blog Post
    ...created constitutive (pCMV-dCas9-D3A) and Tet-dependent (TetO-dCas9-D3A) constructs. For lentiviral expression...Researchers showed that TALE-TET1 constructs, which fused a TALEN to the Tet1 demethylase catalytic domain...with BioRender.com. Tet1 demethylase Ronggui Hu’s lab has created pdCas9-Tet1-CD for targeted cytosine...mammalian cells. This plasmid is used with pcDNA3.1-MS2-Tet1-CD to decrease methylation and activate transcription...lentiviral vector with the same modifier, Fuw-dCas9-Tet1CD, is available from Rudolf Jaenisch’s lab in plasmid... ready-to-use lentivirus. Figure 2: dCas9-Tet1 demethylates cytosines at promoters and enhancers...increased transcription. Created with BioRender.com. Tet1 initiates cytosine demethylation of DNA. However...
  10. Hot Plasmids: Fall 2025

    Type
    Blog Post
    ...procedure for xenograft experiments. B) Constructs for tet-inducible CRISPRa-AAV engineering. Adapted from Nguyen...
  11. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...has used an inducible MitoTimer reporter using a Tet-on system (pTRE-Tight-MitoTimer) to show its usefulness...repressor plasmids from Scot Wolfe's lab. These include Tet-inducible CRISPR activators and repressor plasmids...
  12. Luciferase Plasmid Collection

    Type
    Collection
    ...Luciferase Firefly TRE Lentiviral vector with dox- or tet-inducible luciferase expression Stephen Tapscott ...expression of firefly luciferase William Kaelin 60495 pSBtet-GP Firefly TRE Dox-inducible expression of firefly...
  13. Sequencing Primers

    Type
    Guide
    ...' end of tdTomato Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R...origin Forward pBRforBam CTTGGAGCCACTATCGAC In pBR322 tet region, upstream of BamHI site Forward pBRforEco ...Forward pBRrevBam GGTGATGTCGGCGATATAGG In pBR322 tet region, downstream of BamHI site Reverse pCAG-F GCAACGTGCTGGTTATTGTG...GAGTCACTTTAAAATTTGTATACAC ADH terminator Reverse pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward...
  14. Bacterial Expression Systems

    Type
    Collection
    ...Controlled Expression Resources Check out our Tetracycline (Tet) Inducible Expression Collection for an extensive...Expression Species PI 44249 pdCas9-bacteria pTetO Anhydrotetracycline (aTc) Escherichia coli Stanley Qi 11518...coli Andreas Moeglich 68940 pRMC2 Pxyl/TetO Anhydrotetracycline (aTc) Staphylococcus aureus Tim Foster...glutamicum Timothy Lu 17972 pSE100 Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium...tuberculosis Sabine Ehrt 44561 pST-KT Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium...extorquens Christopher Marx 44448 pLC291 pR/TetO Anhydrotetracycline (aTc) Methylobacterium extorquens Christopher...baumannii Jason Peters 127088 pMS17 tcp830 Anhydrotetracycline (aTc) Streptomyces sp. Maggie Smith 74065...
  15. Promoters

    Type
    Guide
    ...as shRNAs and gRNAs. Additional Resources Tetracycline (Tet) Inducible Expression Plasmids 101: The Promoter...elongation factor promoter TRE Inducible Multiple Tetracycline response element promoter; often optimized for...
  16. Brain Initiative Collection

    Type
    Collection
    ...Gradinaru 117383-AAV1 TRE-DIO-eYFP An AAV genome with tet-inducible, Cre-dependent expression of the fluorescent...
  17. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...inserting OsTIR1 into the "safe harbor" AAVS1 locus (a tet-inducible OsTIR1 plasmid is also available). Second...unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many of which ...subunits of the paramagnetic ferritin protein were tethered to the C-terminus of TRPV4 (a pressure-sensitive...
Showing: 21 - 40 of 130 results