Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 54 results for: tomato

Showing: 21 - 40 of 54 results

  1. Newly Updated AAV Data Hub!

    Type
    Blog Post
    ...AAV1 Cre virus combined with a Cre-dependent AAV9 tdTomato virus in the mPFC.  The AAV9 is so strong that...

  2. New Viral Vectors - Spring 2025

    Type
    Blog Post
    ...channelrhodopsin in the retrograde serotype, and a dTomato under the control of the E6 regulatory element,...

  3. New Viral Vectors - March 2024

    Type
    Blog Post
    ...PHP.eB Controls Roth New serotype pAAV-hDlx-Flex-dTomato-Fishell_7 AAV2 Controls Fishell New serotype ...

  4. Hot Plasmids - October 2022

    Type
    Blog Post
    ... cations. B) Cortical slice of HcKCR1-EYFP and tdTomato expressed layer 2/3 neurons in mouse. C) Action...

  11. Sequencing Primers

    Type
    Guide
    ...forward primer tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT...TCTTTGATGACGGCCATGT 5' end of tdTomato, reverse primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance...

  13. Brain Armamentarium

    Type
    Collection
    ...Gradinaru 218792-AAV1 pAAV_BiLAMP5e3_dTomato_nlsdTomato AAV construct with dTomato driven by Lamp5 interneuron-targeting...218792-PHPeB pAAV_BiLAMP5e3_dTomato_nlsdTomato AAV construct with dTomato driven by Lamp5 interneuron-targeting...Gradinaru 213944-AAV1 pAAV_BiSSTe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by SST interneuron-targeting...Wilson 213944-PHPeB pAAV_BiSSTe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by SST interneuron-targeting...Gradinaru 213940-AAV1 pAAV_BiPVe3_dTomato_nlsdTomato AAV construct expressing dTomato driven by PV+ basket...Wilson 213940-PHPeB pAAV_BiPVe3_dTomato_nlsdTomato AAV construct expressing dTomato driven by PV+ basket...Gradinaru 213936-AAV1 pAAV_BiPVe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by chandelier...

  14. Caltech Systemic Capsids

    Type
    Collection
    ...BiLAMP5e3 dTomato/nlsdTomato Control Fishell 213936 pAAV_BiPVe4_dTomato_nlsdTomato BiPVe4 dTomato/nlsdTomato...pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Control...Control AIBS , Ting 213814 pAAV_BiSSTe10_dTomato_nlsdTomato BiSSTe10 dTomato/nlsdTomato Control Fishell 213829...213829 pAAV_BiCHATe27_dTomato_nlsdTomato BiCHATe27 dTomato/nlsdTomato Control Fishell 213855 pAAV_BiVIPe4...BiVIPe4 dTomato/nlsdTomato Control Fishell 213914 pAAV_BiLAMP5e3_dTomato_nlsdTomato_nlsdTomato BiLAMP5e3...Control Fishell 213940 pAAV_BiPVe3_dTomato_nlsdTomato BiPVe3 dTomato/nlsdTomato Control Fishell 213944...213944 pAAV_BiSSTe4_dTomato_nlsdTomato BiSSTe4 dTomato/nlsdTomato Control Fishell Chemogenetics 44361 pAAV-hSyn-DIO-hM3D...

  15. Brain Initiative Collection

    Type
    Collection
    ...83894-AAV1 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAV2 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAV5 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAV9 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAVrg pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83896-AAV1 pAAV-hDlx-GiDREADD-dTomato-Fishell-5 Gi-DREADD (P2A) nuclear dTomato expression in forebrain GABA-ergic...83896-AAV9 pAAV-hDlx-GiDREADD-dTomato-Fishell-5 Gi-DREADD (P2A) nuclear dTomato expression in forebrain GABA-ergic...

  16. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...pAdx-CMV-iCre-P2A-tdTomato 73351 Expresses iCre and tdTomato from the CMV promoter pAdxEF1-FLPe-tdTomato 73352 Expresses...expressed by another vector pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed...vector pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 Cre is coexpressed with tdTomato and Pac (puromycin N-acethyl-transferase... CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...expressed by another vector pCDH-EF1-Fon-tdTomato 72261 Expresses tdTomato from the EF1 promoter when FLP is ...EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7-...copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses tdTomato from the CMV promoter pAdx-CMV-YFP...

  17. Control AAV Preps

    Type
    Collection
    ... Edward Boyden 44332 pZac2.1 gfaABC1D-tdTomato gfaABC1D tdTomato Constitutive 5 Baljit Khakh 50465 pAAV-hSyn-EGFP...PHP.eB Bryan Roth 51506 AAV phSyn1(S)-tdTomato-WPRE hSyn tdTomato Constitutive 5 Hongkui Zeng 58909 pAAV-GFAP104...Constitutive 5 Edward Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB,...Maarten Kole 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Constitutive 9, PHP.eB Guoping Feng... 9, rg* Karl Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, 9, rg*, PHP.eB...Gordon Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx dTomato Cre dependent 1, 2, 5, 9, rg* Gordon...Constitutive 2 Edward Boyden 128434 pAAV-Ef1a-fDIO-tdTomato EF1a tdTomato Flp dependent 1 Patricia Jensen 99133 pAAV-CAG-fDIO-mNeonGreen...

  18. Retrograde AAV viral preps

    Type
    Collection
    ...Cre-dependent Control Bryan Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Edward Boyden 50457 pAAV-hSyn-DIO-EGFP...Control Karl Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Edward Boyden 27056...Gordon Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx dTomato Control Gordon Fishell 104055 pAAV-CAG-eYFP...107738 pAAV-hSyn-Cre-P2A-dTomato Syn Cre expression with simultaneous dTomato expression Recombinases ...AAV-hSyn1-GCaMP6f-P2A-nls-dTomato Syn GCaMP6f and physically separate nuclear dTomato Calcium sensor Jonathan...-DIO-GCaMP6f-P2A-nls-dTomato EF1a GCaMP6f and physically separate nuclear dTomato, Cre-dependent Calcium...AAV-hSyn1-GCaMP6s-P2A-nls-dTomato Syn GCaMP6s and physically separate nuclear dTomato Calcium sensor Jonathan...

  19. Optogenetics AAV Preps

    Type
    Collection
    ...ChrimsonR tdTomato Cre dependent 1, 5 Edward Boyden 62726 pAAV-Syn-Chronos-tdTomato Syn Chronos tdTomato Constitutive...Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Karel Svoboda 75470...ChrimsonR tdTomato Constitutive 1, 5, 9 Edward Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ChrimsonR... 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato Flp dependent 8 Edward Boyden 100049...Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1, 9 Patricia Jensen... Edward Boyden 28305 pAAV-FLEX-ArchT-tdTomato CAG ArchT tdTomato Cre dependent 5 Edward Boyden 50972 AAV-SYP1...Boyden 84446 pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] CAG Jaws tdTomato Cre dependent 1, 5, 8 Edward Boyden...

  20. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng...100048-AAV1 pAAV.CAG.LSL.tdTomato Hongkui Zeng AV-9-ALL856 100048-AAV9 pAAV.CAG.LSL.tdTomato Hongkui Zeng...Wilson AV-5-PV3106 44332-AAV5 pZac2.1 gfaABC1D-tdTomato Control Baljit Khakh AV-8-PV0101 105530-AAV8 pAAV.CMV.PI.EGFP.WPRE.bGH...Wilson AV-1-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Optogenetics Scott Sternson AV-1-20071P 20071-...Deisseroth AV-5-PV2510 28305-AAV5 pAAV-FLEX-ArchT-tdTomato Optogenetics Ed Boyden AV-5-PV2527 99039-AAV5 ... Kim AV-10-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-10-PV1963 105542-AAV1 pENN.AAV.CB7...Wilson AV-5-18917P 18917-AAV5 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-20071P 20071-AAV5 pACAGW-ChR2...
Showing: 21 - 40 of 54 results