We narrowed to 560 results for: cat.3

.../ I203R) (2) and PA-mRFP1(S146H / I161V / I197H) (3) were derived from DsRed and mRFP, respectively. When...PubMed PMID:19169259. PubMed Central PMCID:PMC2901231. 3.Verkhusha, Vladislav V., and Alexander Sorkin. "Conversion...up. Applications of photoactivatable fluorescent proteins Some of the most important applications for ...conventional FP imaging. PA-FPs are divided into 2 main categories - those with irreversible and reversible photoactivation...photoactivation - and have enabled sophisticated imaging techniques.     Irreversible photoactivation Irreversible...level of background fluorescence. For any PA-FP application, the brighter the fluorescence the better. More...photoactivation. A high contrast ratio usually indicates that a PA-FP has a low level of spontaneous fluorescence...

...and New Faculty" downloadable book. Skip to Chapter 3 for tips on how to develop your role as a lab leader...environment for research is totally dependent on communication amongst the team so getting everyone talking...

...the filters on the right to find single, dual, and 3+ cutters. You can also sort enzymes by clicking on...function. You can also click one location in the plasmid and then a second location to select the sequence between...two separate locations in the linear sequence selects the sequence between the two locations and sends it...table includes feature names, locations, sizes, colors used to indicate them on the map, direction (if...promoters, origins, tags, and certain ORFs. Their sophisticated detection algorithm easily and precisely identifies...restriction enzyme annotations throughout the map at locations better aligned to their precise positions within...between the two locations and send it to the clipboard for copy and paste functionality. Sequence ...

...any DNA they were bound to (2) fragmented the DNA (3) used antibodies to specifically select for proteins...next-gen sequencing. ChIP is an incredibly useful application for exploring these interactions, and can give... protein interactions, including epigenetic modifications. But it's not an approach for the faint of heart...background information. Your options for this step are sonication, which uses high-frequency sound waves to break...break up the DNA, or enzymatic digestion. Sonication provides a truly random digestion, but is harsher ...to the selective nature of the cutting. While sonication is usually the preferred method, enzymatic digestion...concentration.  Protein Capture After crosslinking and sonication or enzymatic digestion, you’re ready to incubate...

...of the selection reagent). Cells should die within 3-5 days and resistant colonies appear in about 10-14... a bacterial origin of replication (ORI) will not allow for plasmid replication in mammalian cells, for... their bacterial counterparts, including how replication occurs and whether selection is necessary for...the nuclear genome, in the absence of plasmid replication, the foreign DNA will be degraded or diluted ...always mission critical to make sure the plasmid replicates in the cell, as many of these experiments are...expressed in trans within the cell for effective replication. Cell lines expressing the Epstein–Barr virus...antigen (293E or 293T cells), allow for episomal amplification of plasmids containing the viral EBV or SV40...

...great tool for someone starting cell culture work. 3. NEB Tools by New England BioLabs In my lab we do ...Gibco organizes its app into four categories: tools, analytics, education and data manager. The tools are...are five FREE science lab apps that have been educational and great for lab life. These apps prevent you...lab notebook. Lab Archives is a multipurpose application that allows you to share your data with colleagues...other nice features. This app also has a great educational section. This section holds the Gibco Cell culture...directions including which buffers to use and that indicates if a sequential digest is needed. The enzyme finder... to this app; the user can search by sequence, category of enzyme, or name to discover all the information...

... produce and distribute virus. Addgene is a 501(c)3 nonprofit and our plasmid service was started based...Addgene started distributing a small but growing catalog of ready-made AAV and Lentiviral preps. This new...directions. I would like to thank them for their time, dedication, advice and encouragement. Why virus? Why did...performs extensive quality control, generates  educational materials, and provides viral vector technical...answering questions on virus and helping provide educational resources on this collection. With their expertise... resource and providing fantastically useful educational content on viral vectors.  How Addgene’s Viral...about the new initiative and serving all the new educational content via the Addgene Blog and our expanding...

... lab E. coli K12 strains such as DH5alpha contain 3 methylases that recognize and methylate different ... one half of naturally occurring restriction modification systems that prokaryotes use to protect themselves... has genes encoding one or a few restriction modification systems containing methyltransferases that add... phage for instance). Aside from restriction modification systems, DNA methylation also plays an integral...integral role in regulating genome replication, repairing mismatched basepairs or small indels that occur...methylases) are independent from the restriction modification systems, yet can still affect whether certain...specifically associated with any restriction modification systems, their sequences may overlap with restriction...

... minutes of my hands on time and a total of about 3 hours. It was robust, capable of generating a wide...processing, these small DNA strands can form concatemers in later steps. This new NEB kit includes a step...fragments the DNA and prevents it from forming concatemers later. The "FS" stands for Fragmentation System...repair Adapter Ligation Clean up/Size selection Amplification Clean up  I found this kit easy to use because...DNA we started the process with, we got great amplification of our sample libraries. NEB also gave us a ...mostly used to make new libraries as opposed to replicating them like we do at Addgene), going to the workshop...

...engineered a DAP array for prime editing, achieving up to 3-loci MPE with similar high efficiencies, which is ...packaged into viral vectors for potential in vivo applications or multiplex CRISPR screening.   Using tRNAs...multiplex genome engineering of crops or allow for sophisticated CRISPR screenings that would perturb the unprecedented...and efficient in plasmid and viral vectors. In applications when repetitive tRNA sequences must be avoided...construct DAP array for multiplex gene editing applications, we provide detailed manual and online design...

...cytoplasmic (CKB1) RNA target. Adapted from Figure 3 Colognori et al 2022.   Find CRISPR Csm plasmids...antibodies may just not perform as well in one application as another, so it is always best to have options...for mEGFP-HRas (from Plasmid 18662). See the Applications section on the Anti-GFP [N86/8R] page for more...fluorescent proteins (FPs) necessary for many of these applications have lagged. Fixation, chemical staining, and...well-suited for the demands of advanced microscopy applications such as super resolution, electron, and expansion...

...specifically expressing Cre in the hippocampus (Fig. 3). The Cre-dependent AAV would access the neurons (...Tracers are typically delivered to a particular location and they either trace downstream from the soma...Others have noted a lack of transduction in catecholamine pathways from the spinal cord (Wang, 2018, Metcalfe...not yet understood, one thing is clear: this application opens a lot of doors in neuroscience. The retrograde...retrograde serotype also has promising therapeutic applications; it can enhance therapeutic delivery across ...

... genetic modification by homologous recombination. In most recombineering strategies, only 3-4 phage proteins... the steps of gel purification and in vitro recombination. Across all modifications described in Trehan...mutations, large deletions/insertions require complicated, often costly in vitro assembly methods. A new...

...will likely bring about unwanted immunogenicity. The 3-D models can be applied to corroborate the occurrence...silico approach The in silico approach cannot replicate the complexity of antigen processing events that...This system would somewhat act like a 2-step verification. All approaches have their own limitations. ... together can inform decisions about in vivo application and clinical testing. This would pave the way...

... Obligate aerobe Number of chromosomes 16 3 4 Preferred carbon source Glucose Glucose...2017). Beyond human relevance, yeast have many applications in food science and biotech due to its fermentation... ancient yeast strains and metazoan cells.   Applications for K. phaffii There’s a number of different...is exceptionally good for post-translational modification of recombinant protein products, specifically...

...anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG...: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG...To do this, we add 5' - AATTC and G - 3' to the top oligo and 3' - G and CAGCT - 5' to the bottom oligo...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...CCGCGCGG GTTAAC CAGCT - 5' Note: We could leave off the 3’ G on each oligo (and the complementary C of the other...tube. Place tube in 90-95°C hot block and leave for 3-5 minutes. Remove the hot block from the heat source... vector in molar ratios (vector:insert) between 4:3 and 1:6 in a standard ligation reaction (ex. to ligate...

...an updated protocol), send an email instead. The 3 A's - Agendas, Action items, and Accountability Agendas... dialogue and community among participants, clarification - new and useful information, and invigoration...be the representative in the meeting and then communicate outcomes to the rest of their team. Here's a ...

...development since its inaugural year in 2012. That’s just 3 to 4 years ago. It is a bubble of innovation (a piñata...PMID: 23873081. PubMed Central PMCID: PMC3969858. 3. Doench, John G., et al. "Rational design of highly...into this category describe how the user is expected to interact with the software. This category is important... CRISPR software submissions. With few prior publications to go on, a submitted manuscript could only ... solutions that facilitate most experimental applications in CRISPR engineering. When compared to that...easy to fault the lack of features in a single application. The question is then, should we use all tools...1 Jan 2013, no longer available), is a simple catalogue of reported sgRNA designs. The second database...

...edits. Figure 3: Mechanism of cytosine transversion editors. Red arrows indicate a conversion directly...guide RNA, (2) a complementary DNA sequence, and (3) a protospacer-adjacent motif (PAM) on the opposite...directly catalyzed by the base editor. Black arrows indicate natural cellular processes. Created with BioRender.com...editing works in general. Base editors use either catalytically dead Cas9 (dCas9) or a Cas9 nickase (nCas9) ...excision repair (BER), the cellular process that catches mutated U’s in DNA and ideally converts them back...terms gRNA/sgRNA Guide RNA RNA used by Cas9 to locate a matching DNA sequence.   Target strand The ...directed base excision repair proteins. Nature Communications, 12(1), 1384. https://doi.org/10.1038/s41467...

... scientists have certainly not lost site of that. 3. Stem cell science is hard, and expensive Dr. Yamanaka... have profound impacts on the development of applications with the potential to save lives. While most...