We narrowed to 432 results for: %s
-
TypeBlog Post...24700457. PubMed Central PMCID: PMC4077948. Yan, Kelley S., et al. "The intestinal stem cell markers Bmi1 and...
-
Targeting HIV-1 with CRISPR: Shock and Kill or Cut it Out?
TypeBlog Post...Addgene. Wang Z, Pan Q, Gendron P, Zhu W, Guo F, Cen S, Wainberg MA, Liang C. CRISPR/Cas9-Derived Mutations... -
Plasmids 101: Gibson Assembly and Other Long-Homology Based Cloning Methods
TypeBlog Post...: 19363495. 2. Wang JW, Wang A, Li K, Wang B, Jin S, Reiser M, Lockey RF. CRISPR/Cas9 nuclease cleavage... -
Building Global Connections with the International Mentorship Program USA-EUROPE
TypeBlog Post... approachable relationship for the mentee, where (s)he feels truly understood and supported, and can more... -
Plasmids 101: Common Lab E. coli Strains
TypeBlog Post...Common gene mutations found in E.coli strains Gene(s) Description Functional Consequence dam DNA adenine... -
CRISPR Guide
TypeGuide...23287722 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., Barrangou,...Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T., Abudayyeh, O. O., Gootenberg, J. S., Mori, H...Chandrasekaran, S. S., Perry, N. T., Schaepe, J., Du, P. P., Lotfy, P., Bassik, M. C., Bintu, L., Bhatt, A. S., & ...PMID: 38216671 Klompe, S. E., Vo, P. L. H., Halpin-Healy, T. S., & Sternberg, S. H. (2019). Transposon-encoded...Scheiman, J., Vora, S., Pruitt, B. W., Tuttle, M., Iyer, E. P. R., Lin, S., Kiani, S., Guzman, C. D., Wiegand..., E. C., Newberry, K. M., Smith, S. B., Meadows, S. K., Roberts, B. S., Mackiewicz, M., Mendenhall, E....Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung... -
Mycoplasma Contamination: Where Does It Come From and How to Prevent It
TypeBlog Post... Kang SH, Bae YJ, Hong JT, Chung YB, Lee CK, Song S (2006) PCR-based detection of mycoplasma species. ... -
Is this the right place for me? 8 tactics for choosing a lab
TypeBlog Post...do in the future. Questions to ask: Will someone(s) train you technically? Will the PI/supervisor look... -
Scientific Reproducibility - Focusing on Solutions at the Minisymposium on Reproducibility
TypeBlog Post...1:24 - 29:31 - Reproducibility Overview - Jeffrey S. Flier, Researcher at Harvard Medical School, former... -
Technologies Enabled by NanoLuc® Luciferase
TypeBlog Post...27786307. PubMed Central PMCID: PMC5476805. 8. Inagaki, S., et al. (2017) Genetically encoded bioluminescent... -
Adenovirus Guide
TypeGuide...Adenoviral Vector topics References Ahi, Y. S., Bangari, D. S., & Mittal, S. K. (2011). Adenoviral vector immunity...) Ewer, K. J., Sebastian, S., Spencer, A. J., Gilbert, S. C., Hill, A. V. S., & Lambe, T. (2017). Chimpanzee... new window) Lee, C. S., Bishop, E. S., Zhang, R., Yu, X., Farina, E. M., Yan, S., Zhao, C., Zheng, Z....J., Stanley, D., Honko, A., Johnson, J., Mulangu, S., Pau, M. G., Custers, J., Vellinga, J., Hendriks,...PMID: 21325402 (Link opens in a new window) Gilbert, S. C. (2015). Adenovirus-vectored Ebola vaccines . Expert...26289977 (Link opens in a new window) He, T. C., Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W., & Vogelstein... Li, Y., Zhang, W., Yang, C., Wu, K., Wu, Y., Ho, S., Athiviraham, A., Lee, M. J., Wolf, J. M., Reid, ... -
Gamma-Retroviral Vector Guide
TypeGuide...Ravin, S. S., Su, L., Theobald, N., Choi, U., Macpherson, J. L., Poidinger, M., Symonds, G., Pond, S. M.,..., Abreu, S., Rubat, L., Nikoniuk, A., Macmorland, W., Horlock, C., Matsumoto, S., Williams, S., Smith,...Viral Protocols References Coffin, J. M., Hughes, S. H., & Varmus, H. E. (Eds.). (1997). Principles of...., Ferris, A. L., Hughes, S. H., Malech, H. L., & Wu, X. (2014). Enhancers are major targets for murine...., Wolfsberg, T. G., Baxevanis, A. D., & Burgess, S. M. (2014). MLV integration site selection is driven...Smith, K., Price, J., Srivastava, S., Hussain, R., Banani, M. A., Day, W., Stevenson, E., Madigan, M., Chen...doi.org/10.3390/v13081471 PMID: 34452336 Schnierle, B. S., Stitz, J., Bosch, V., Nocken, F., Merget-Millitzer... -
Lentiviral Vector Guide
TypeGuide... Kim, H. S., Hwang, G., Lee, H. K., Bae, T., Park, S., Kim, Y. J., Lee, S., Park, J., Bae, S., & Hur, ..., J. N., Norberg, S. M., Hinrichs, C., Highfill, S. L., Somerville, R. P., Panch, S. R., Jin, P., & Stroncek...36348415 Stewart, S. A., Dykxhoorn, D. M., Palliser, D., Mizuno, H., Yu, E. Y., An, D. S., Sabatini, D. ...30518911 Wells, D. W., Guo, S., Shao, W., Bale, M. J., Coffin, J. M., Hughes, S. H., & Wu, X. (2020). An ...10.1128/jvi.72.11.8463-8471.1998 PMID: 9765382 Durand, S., & Cimarelli, A. (2011). The inside out of lentiviral...., Edavettal, J. M., Swaminathan, T. A., & Braun, S. E. (2021). HIV-based lentiviral vectors: Origin and...Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl, D., Ebert, B. L., Root, D. E., Doench, J.... -
Custom CRISPR Screens & the Green Listed Software
TypeBlog Post...that the output text files can be hard to read. It´s suggested that you open the above text files, copy... -
Quick Guide to All Things Lentivirus
TypeBlog Post...applied research since their first use in the early 90’s to genetically modify primary cells. Amongst the different... -
Lambda Red: A Homologous Recombination-based Technique for Genetic Engineering
TypeBlog Post...-100 nucleotides long with the desired alteration(s) located in the center of the sequence. Since lambda... -
Finding Your Perfect Job After University
TypeBlog Post...Being a scientist in my late 20’s, new graduates often ask me for advice on careers available to new ... -
Sequencing Primers
TypeGuide...Invitrogen) S. cerevisiae GAL1 promoter, forward primer Gal10pro-F GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG... reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG...promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer OpIE2 Forward... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer pGP704-R AACAAGCCAGGGATGTAACG... -
Plan Your Experiment
TypeGuide...designed your gRNA(s), the next step is to choose how to express your Cas enzyme and gRNA(s) in your target...., Adamson, B., Norman, T. M., Lander, E. S., Weissman, J. S., Friedman, N., & Regev, A. (2016). Perturb-Seq...Ploegh, H. L., Bassik, M. C., Qi, L. S., Kampmann, M., & Weissman, J. S. (2014). Genome-Scale CRISPR-Mediated...References CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a powerful system that...generally only compatible with smaller Cas enzymes, like S. aureus Cas9. For more information, see our blog post... -
Adeno-associated virus (AAV) Guide
TypeGuide..., C., Gorbatyuk, O. S., Velardo, M. J., Peden, C. S., Williams, P., Zolotukhin, S., Reier, P. J., Mandel...B. Y., Viswanathan, S., Gaj, T., Lavzin, M., Ritola, K. D., Lindo, S., Michael, S., Kuleshova, E., Ojala...of AAV serotypes, indicating the optimal serotype(s) for transduction of a given organ. Tissue Optimal...W. L., Sánchez-Guardado, L., Lois, C., Mazmanian, S. K., Deverman, B. E., & Gradinaru, V. (2017). Engineered...12871018 (Link opens in a new window) Hüser, D., Weger, S., & Heilbronn, R. (2003). Packaging of human chromosome...