Skip to main content
Addgene

We narrowed to 430 results for: {{{s}}}

Showing: 401 - 420 of 430 results
  1. CRISPR Guide

    Type
    Guide
    ...23287722 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., Barrangou,...Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T., Abudayyeh, O. O., Gootenberg, J. S., Mori, H...Chandrasekaran, S. S., Perry, N. T., Schaepe, J., Du, P. P., Lotfy, P., Bassik, M. C., Bintu, L., Bhatt, A. S., & ...PMID: 38216671 Klompe, S. E., Vo, P. L. H., Halpin-Healy, T. S., & Sternberg, S. H. (2019). Transposon-encoded...Scheiman, J., Vora, S., Pruitt, B. W., Tuttle, M., Iyer, E. P. R., Lin, S., Kiani, S., Guzman, C. D., Wiegand..., E. C., Newberry, K. M., Smith, S. B., Meadows, S. K., Roberts, B. S., Mackiewicz, M., Mendenhall, E....Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung...
  2. Adenovirus Guide

    Type
    Guide
    ...Adenoviral Vector topics References Ahi, Y. S., Bangari, D. S., & Mittal, S. K. (2011). Adenoviral vector immunity...) Ewer, K. J., Sebastian, S., Spencer, A. J., Gilbert, S. C., Hill, A. V. S., & Lambe, T. (2017). Chimpanzee... new window) Lee, C. S., Bishop, E. S., Zhang, R., Yu, X., Farina, E. M., Yan, S., Zhao, C., Zheng, Z....J., Stanley, D., Honko, A., Johnson, J., Mulangu, S., Pau, M. G., Custers, J., Vellinga, J., Hendriks,...PMID: 21325402 (Link opens in a new window) Gilbert, S. C. (2015). Adenovirus-vectored Ebola vaccines . Expert...26289977 (Link opens in a new window) He, T. C., Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W., & Vogelstein... Li, Y., Zhang, W., Yang, C., Wu, K., Wu, Y., Ho, S., Athiviraham, A., Lee, M. J., Wolf, J. M., Reid, ...
  3. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Ravin, S. S., Su, L., Theobald, N., Choi, U., Macpherson, J. L., Poidinger, M., Symonds, G., Pond, S. M.,..., Abreu, S., Rubat, L., Nikoniuk, A., Macmorland, W., Horlock, C., Matsumoto, S., Williams, S., Smith,...Viral Protocols References Coffin, J. M., Hughes, S. H., & Varmus, H. E. (Eds.). (1997). Principles of...., Ferris, A. L., Hughes, S. H., Malech, H. L., & Wu, X. (2014). Enhancers are major targets for murine...., Wolfsberg, T. G., Baxevanis, A. D., & Burgess, S. M. (2014). MLV integration site selection is driven...Smith, K., Price, J., Srivastava, S., Hussain, R., Banani, M. A., Day, W., Stevenson, E., Madigan, M., Chen...doi.org/10.3390/v13081471 PMID: 34452336 Schnierle, B. S., Stitz, J., Bosch, V., Nocken, F., Merget-Millitzer...
  4. Lentiviral Vector Guide

    Type
    Guide
    ... Kim, H. S., Hwang, G., Lee, H. K., Bae, T., Park, S., Kim, Y. J., Lee, S., Park, J., Bae, S., & Hur, ..., J. N., Norberg, S. M., Hinrichs, C., Highfill, S. L., Somerville, R. P., Panch, S. R., Jin, P., & Stroncek...36348415 Stewart, S. A., Dykxhoorn, D. M., Palliser, D., Mizuno, H., Yu, E. Y., An, D. S., Sabatini, D. ...30518911 Wells, D. W., Guo, S., Shao, W., Bale, M. J., Coffin, J. M., Hughes, S. H., & Wu, X. (2020). An ...10.1128/jvi.72.11.8463-8471.1998 PMID: 9765382 Durand, S., & Cimarelli, A. (2011). The inside out of lentiviral...., Edavettal, J. M., Swaminathan, T. A., & Braun, S. E. (2021). HIV-based lentiviral vectors: Origin and...Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl, D., Ebert, B. L., Root, D. E., Doench, J....
  5. Sequencing Primers

    Type
    Guide
    ...Invitrogen) S. cerevisiae GAL1 promoter, forward primer Gal10pro-F GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG... reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG...promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer OpIE2 Forward... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer pGP704-R AACAAGCCAGGGATGTAACG...
  6. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ..., C., Gorbatyuk, O. S., Velardo, M. J., Peden, C. S., Williams, P., Zolotukhin, S., Reier, P. J., Mandel...B. Y., Viswanathan, S., Gaj, T., Lavzin, M., Ritola, K. D., Lindo, S., Michael, S., Kuleshova, E., Ojala...of AAV serotypes, indicating the optimal serotype(s) for transduction of a given organ. Tissue Optimal...W. L., Sánchez-Guardado, L., Lois, C., Mazmanian, S. K., Deverman, B. E., & Gradinaru, V. (2017). Engineered...12871018 (Link opens in a new window) Hüser, D., Weger, S., & Heilbronn, R. (2003). Packaging of human chromosome...
Showing: 401 - 420 of 430 results