We narrowed to 532 results for: abo.3

... The McMurray lab found that low concentrations (≤3 mM) of GdnHCl can functionally rescue multiple Arg-mutant...glycosylation (CDG) are a group of rare inherited metabolic diseases with severe and life-threatening consequences...understood.  In line with this, Prof. Videira and collaborators will use Addgene plasmids to immortalize CDG...discovery led them to investigate the use of a common laboratory chemical, guanidine hydrochloride, as a potential...

...Genetic Analyses in Mice. 2004. PubMed PMID: 14723844. 3. Atasoy D, Aponte Y, Su HH, and Sternson SM. 2008.... Blog  Read about Other Means of Genome Engineering Using FLEx AAV Vectors? Learn about Viral Vector ...12665802. 2. Branda, CS and Dymecki, SM. Talking about a Revolution: The Impact of Site-Specific Recombinases...

... 20, 2022 Workflow Timeline Day 1: Seed cells Day 3-4: Fix and label cells Equipment Pipette controller...a 24-well cell culture treated plate. Seed 5 x 10 3 HeLa cells per well. Allow the HeLa cells to grow ... min in 500 µL PBS on a rocking platform. Section 3: Labeling with antibody Block for 20 min at RT on ...water Microscope slide Anti-fade mounting medium Laboratory wipes 15 mL conical tubes 50 mL conical tubes...paraformaldehyde and follow your institution's laboratory safety guidelines for disposing of waste in the...remove the coverslip. Blot the coverslip with a laboratory wipe to remove excess liquid. Add 1 drop of anti-fade...

...PMID: 16836756. PubMed Central PMCID: PMC1534021. 3. Zhang, Bing, et al. "The significance of controlled...drawback of this approach is that it can be quite labor intensive. Target cells are transduced with serial...

...0: Seed cells in CS2 Day 2: Seed cells in CS5 Day 3 (am): Transfect cells Day 7 (am): Harvest cells Equipment...interest Triton X-100 Benzonase/DNAse I (Millipore 71205-3) 40% Polyethylene Glycol 8000 (PEG) + 0.5 M NaCl Cell... PBS and add 35 mL of 0.05% Trypsin/EDTA. Wait ~2-3 minutes for cells to detach. Gently tap the sides ...stir slowly at 4 °C for 1 h, then keep at 4 °C for 3 h without stirring to allow full precipitation. Precipitation... at 4 °C if needed. Transfer the entire sample to 3 x 500 mL conical bottles and centrifuge at 3900 rpm....8-fold. See the recipe for D1 + 0.1 M sorbitol above. Carefully pour off the media into a waste container...in a total of 5 mL of cell lysis buffer (recipe above). Pipet back and forth to resuspend each pellet ...

... make it easy for your supervisor to support you. 3) Explain the problem and leave your emotions out of... I heard about supervisors in all of the above categories. In addition, I also learned about two other...Complainers, who spend most of their time moaning about their troubles, Silent or unresponsive clams, ... students and postdoctoral fellows are hesitant about expressing their ideas, especially if their supervisors...it is interfering with your work. Avoid talking about your emotions, such as frustration or anger, because... like the problem to be resolved You know more about your work than your supervisor does. You can save...Listen to your supervisor’s viewpoint and brainstorm about mutually beneficial solutions Your supervisor might...

...Originally published Aug 3, 2017 and last updated Apr 6, 2021 by Will Arnold. Introducing NGS in 2017...ask the depositing laboratory to review the discrepancies. If the depositing laboratory confirms that these...finish the library preparation process only takes about one day, even for six plates (576 individual plasmids... we perform a 2x251 run on our MiSeq that takes about two days to complete. After the run completes, we..." In some cases, there will be more information about our sequencing results in the Depositor Comments...to note the appropriate barcode for each sample. About 24 hours later we unload the FASTQ data from our...

...two 96 well plates in just under 3 hours or one 96 well plate in about an hour. Automating vial fiIling... work into finding robots that’ll take a little labor off our hands. Good news! There is probably a machine...96 transformations in one run compared to doing about 50 transformations in the same amount of time by...machinery we have been able to transform 96 samples in about 4 hours with a greater than 95% success rate! Automating...35 minutes compared to a lab assisstant filling about 200 vials in 45 minutes by hand. How can you start...on each tube by hand. We’ll be sure to tell you about more lab updates as we develop them. In the meantime...

...directly back to your specific goal. When thinking about step 3, however, you may be surprised at the number...Delivery methods for mammalian cell lines As mentioned above, the expression system you choose in many ways dictates.... The user should review the current literature about their preferred model.  If your expression system... Check out our CRISPR Featured Topic Page Learn about CRISPR Delivery Using Ribonucleoproteins (RNPs) ...

...expression and high cell-type specificity.  Strategy #3 (ProC): Create promoters by repeating mouse cell type...Addgene blog Read more about using AAV for retinal gene therapy Find more about precise neuronal targeting...injected into macaques and postmortem human retinas. About 25% of these AAV synthetic promoters successfully...

...deposit spreadsheet to complete Step 1. Steps 2 and 3 are usually very easy — our tech transfer team will...streptomycin, tetracycline, combinations of the above, or other. High or Low Copy Choose from: high...the “Purpose” field. If you ever have a question about what should go into a cell, hover over the cell ...Addgene and contact your technology transfer office about the MTA. Pro Tip! Download a new spreadsheet each...

...more advantageous for your search. Timesaving Tip #3: Note that protein databases available are unlikely...such as full plasmid sequences provided by the laboratories that deposit their plasmids with us or other...mismatches and gaps in the alignment. If you are curious about the differences in the blastn programs, check out...Inside Look at NGS Plasmid Quality Control Learn about our Snapgene-powered plasmid maps. Resources on...

...end that is identical to an adjacent segment and a 3′ end that anneals to the target sequence. One strategy...reaction: T5 Exonuclease - creates single-strand DNA 3’ overhangs by chewing back from the DNA 5’ end. Complementary...) to the isothermal reaction mix. ET SSB protects 3’ ssDNA ends from the ssDNA-specific endonuclease activity... the right). When designing your plasmid, think about what DNA segments you will need to join to create...

... 1 µg DNA 1 µL of each Restriction Enzyme 3 µL 10x Buffer 3 µL 10x BSA (if recommended) x µL dH 2 O (to... T4 DNA Polymerase or Klenow DNA Polymerase I for 3′ overhang removal and 5′ overhang fill-in. If you ...more at (Link opens in a new window) NEB's website about star activity . If you are digesting a large number...

...PMID: 24552514. PubMed Central PMCID: PMC3929550. 3. Kaati, Gunnar, Lars O. Bygren, and Soren Edvinsson... the histone protein of interest (in the figure above, H3 at K9 or K27). Joined to this by a flexible ... in Your Experiments Post Read Other Blog Posts about Fluorescent Proteins  ...

...Cells Day 2–3 (am): Remove media, replace with fresh media containing selection reagent Day 3–14: Change...300 200 1:10 150 350 1:50 30 470 1:100 15 485 1:500 3 497 Add 0.5 mL of a single viral dilution to each ...cell death, the cell media should be changed every 2–3 days to maintain the dose of antibiotic, which may...cells in the untransduced well (0 µL lentivirus, above) are dying. Perform regular media changes and monitor...

...ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector/td> Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX... For pBluescript vector Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of MCS in pGEX vectors Reverse ...Sequencing Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia...GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain Forward Gal4-AD AATACCACTACAATGGAT 3' end of Gal4 activation...S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG 3' end of Gateway cassette Forward GW-5'...GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose binding protein Forward mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry... pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...

...PMID: 25357182. PubMed Central PMCID: PMC4289409. 3. Rouet, Romain, et al. "Receptor-Mediated Delivery...scientists to make genomic alterations, bringing about a revolution in genome engineering, with new techniques...available by both the Jacob Corn and Alex Schier laboratories. Delivering Cas9-gRNA ribonucleoproteins  An...delivery of RNPs is electroporation (A in the figure above), which generates pores in the cell membrane, allowing...as lipid-mediated transfection (B in the figure above), are in the early stages of development. David ...proteins harboring receptor ligands (C in the figure above), which result in the internalization of Cas9-gRNA...show promise for in vivo studies, little is known about the immunogenicity and stability of the Cas9 protein...

...important is letting people know it’s happening. Aim for 3-4 weeks advance notice for the first meeting so that...think about. Choosing a topic and gauging interest The first thing to do if you’ve thought about starting... discussions. Beyond the excitement of learning about new cutting edge science, researchers of all varieties...help stay current on new and emerging work by collaboratively discussing recent publications in a specific...up. At Addgene, we wanted to think more closely about the wealth of high-throughput sequencing (HTS) data...the paper.  Before the first journal club, think about the meeting itself A journal club should aim to ...published science. They also serve as a way to learn about work outside of one's own field in a structured ...

...Amplifying genetic logic gates." Science. 340, 599-603 (3 May 2013). Vivek Mutalik et al. "Precise and reliable...Foundation's Linda Kahl explains the Addgene collaboration this way: "Addgene is one of the leaders in ... our core values." Addgene spoke with Endy more about the BIOFAB and BIL gates plasmid kits, the Biobricks...reference to George Boole who in 1854 was thinking about logic and analyzing human language and observed ... freely available? Endy: When we start thinking about languages, humans have two types of languages: one...does; it's free to use and that tends to be true about most successful human-to-human languages. Who owns...signals. Let's say I wanted to detect every primary metabolite in a cell. The only way to do that at scale right...