We narrowed to 560 results for: cat.3

...10) and grow them in a small culture volume (2 or 3 ml) containing the corresponding antibiotic, extract...constructs. His work was acknowledged in hundreds of publications including Cell, Nature, and other journals. ...

...in Vector Transgene Expression. Hum Gene Ther, 31(3–4), 151–162. https://doi.org/10.1089/hum.2019.274.... ITRs serve as the origin of replication and are required for replication, packaging, and vector persistence...viral rep (replication) and cap (capsid) proteins, which bind to the ITRs and initiate replication. ITRs are...structures, ITRs are prone to replication errors and disruptive mutations and truncations that can make vector ...binding site for Rep78 and Rep68 to initiate replication and a terminal resolution site that serves as...are noted. Created with biorender.com. ITR modifications and types  Since ITRs are one of the most important...important elements of AAV and rAAV vectors, modifications can affect gene transfer efficiency and transgene...

...ankyrin repeat proteins. DARPins typically consist of 3-4 repeats, have high specificity and binding affinity...re used in a number of research and clinical applications. Most of the time, when someone speaks about...deeper penetration into a tissue, useful for applications like IHC, or be able to access an epitope folded...that would size-exclude an antibody. In imaging applications, smaller affinity reagents means higher resolution...antibody’s ‘Y’. They are often used in clinical applications. Fab fragments can be created in lab in situations...Shahied, 2004). They are often used for clinical applications, including imaging.  Diabodies are ~60 kDa proteins...antibodies are still an excellent option for many applications, and frankly, if ain't broke, don't fix it!  ...

...enter the cells so they can go to work. Figure 3: Inducing the double strand break and introducing ...visit the Cell Catalog on the Allen Cell Explorer, where you can also find the certificate of analysis provided...signal that makes it hard to visualize the precise location of the protein or structure of interest. Endogenous...technology, inserting large tags into a precise location in the genome is still inefficient, particularly...from these cell lines can be found in the Cell Catalog on our data portal. The plasmids should be functional...

...chains. 3) Endogenous carbohydrates added to antibodies post-translationally. 4) Modifications made to...These properties allow for efficient signal amplification, making biotin conjugated antibodies good options...especially if you start to consider clinical applications). But there are a few other classes that we ...proximity ligation, immuno-PCR, and single-cell applications (Hegazy, et al., 2020; Niemeyer, et al., 2007...also conjugate antibodies directly to beads for purification purposes.  Coupling up - antibody conjugation...Detecting Protein-Protein Interactions and Protein Modifications in Cells and Tissues in Situ. Curr Protoc Cell...

... to have either salaries raised or hours tracked, 3% of postdocs were at institutions focused only on ...days prior to the implementation date, our data indicated that, while 69% of all postdocs were expected ...sent, with the lack of transparency and poor communication of their plans (many postdocs - and in some ...to reach out to institutions with a statement indicating that we encourage them to keep raising salaries... little correlation with cost of living at the location of the institution. Continuing efforts to gather...Director of Future of Research. He is interested in advocating for and with junior scientists, to help them ... Bring Increased Postdoc Wages Read about the Advocating for Science Symposium and Workshop Learn about...

...PMID: 24529477. PubMed Central PMCID: PMC4139937. 3. Anders, Carolin, et al. "Structural basis of PAM-...As evidenced by all the CRISPR publications, press, and plasmids out there, it’s obvious that CRISPR ...nickase variant, lowering Cas9 expression, and truncating gRNA sequences used for targeting; however, these...on-target and off-target activity at multiple genomic locations in HEK cells. Further testing of two of the mutants...PubMed PMID: 26628643. Find plasmids from this publication at Addgene. 2. Nishimasu, Hiroshi, et al. "Crystal...PubMed PMID: 26735016. Find plasmids from this publication at Addgene. 5. Chen, JS, et al. "Enhanced proofreading...PubMed PMID: 28931002. Find plasmids from this publication at Addgene. Resources on the Addgene Blog Read...

...PMID: 26258682. Find plasmids from this publication at Addgene. 3. Kirchhofer, A., et al. “Modulation of...repurpose popular GFP reporter lines for more sophisticated experimental manipulations, saving the time ..., 98% of TdTomato expressing cells were GFP+, indicating a robust, but specific system. T-DDOGs also successfully...systems are easily adaptable to neuroscience applications, including optogenetics, and they should make...Could Cas9-DOG be developed soon to allow genome modification only in a small subset of cells? Other proteins... PMCID: PMC4096992. Find plasmids from this publication at Addgene. 2. Tang, Jonathan C.Y., et al. “...

...coaching. Always ask for references and follow up with 3-4 to hear about those clients’ experiences. Good coaches...choose well. What are their qualifications? Do they have certifications? How can they demonstrate their...  Check out Joanne's Reddit AMA I am a strong advocate for peer mentoring, but volunteer mentors are ...help you. A good coach usually will be a clear communicator and make direct suggestions for improvement ...coaching is nice if you can get it.  Because I am located in Cambridge, MA (and because we have a lot of ...she is especially excellent in coaching for communication skills. Industry transition is also an area ...

...one locus (e.g. Cre) and heterozygous at the other. 3. Breed your F1 generation Now, your goal is to generate...techniques that can be used to introduce genetic modifications into mouse embryos. But once you generate a ...techniques are each useful for introducing one modification into the mouse genome, they are not commonly...parental mice In order to ensure that your genetic modification will be passed along to all of the offspring...environment and will harbor similar epigenetic modifications. Special breeding cases Whether your mouse colony...the mutations that you are trying to cross are located on homologous chromosomes in the parental generation...

...endonuclease of a class 2 CRISPR-Cas system. Cell, 163(3): 759-771 (2015). 10.1016/j.cell.2015.09.038 Harrington...a defined site to form a clean DNA break, Cas3 locates its target sequence and initiates single stranded... out large regions of DNA and has anti-viral application potential as a result. Fast facts – PAM requirement... has been proposed to be useful for the same applications (RNA knockdown, RNA editing, etc.). The main...

...Genetic Analyses in Mice. 2004. PubMed PMID: 14723844. 3. Atasoy D, Aponte Y, Su HH, and Sternson SM. 2008....sites directs the Cre recombinase to invert, translocate, or excise a DNA fragment. The availability of... the function of various point mutations and truncations in the absence of the endogenous gene. Spatio-temporal..., allowing for clearer characterization of the location, morphology, and circuit mapping of a targeted...

...pENTR-R ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector/td> Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of... For pBluescript vector Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of MCS in pGEX vectors Reverse ...Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia vectors with.... cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG 3' end of Gateway cassette Forward GW-5' ... pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...AATACCACTACAATGGAT 3' end of Gal4 activation domain Forward GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP Forward...GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose binding protein Forward mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry...

...either as this also results in a generic invitation. 3) Connect with people you have really talked to The... example, I will often see a whole bunch of notifications “a postdoc from this Uni viewed your profile...look straight at the camera. Pro tip: Turn off notifications to your network of profile changes. If you are...

...against the antigen bound to the plate. Figure 3: Overview of using Direct ELISA to quantitatively ...the most common type of competitive ELISA is a modification of the sandwich ELISA as described here, the...ELISA, the only difference being the additional amplification step, which helps to visualize low-abundance...

... The McMurray lab found that low concentrations (≤3 mM) of GdnHCl can functionally rescue multiple Arg-mutant...Rescue occurs through guanidinium cation (Gdm+) binding in the location formerly occupied by the Arg sidechain...

...PMID: 16836756. PubMed Central PMCID: PMC1534021. 3. Zhang, Bing, et al. "The significance of controlled...particle. Consequently, titers based off of p24 quantification tend to be overestimates since they can include...quantify the amount of PCR product that comes from amplification of the original plasmid which can over-inflate...

... Toolbox for Plants.” ACS Synthetic Biology, vol. 3, no. 11, American Chemical Society (ACS), 20 Feb. ...and applications.    Plant applications We outlined many synthetic biology MoClo applications, but...- and multi-gene constructs for a variety of applications. MoClo tools can be used in bacterial and cell-free...and the kits Addgene offers to kickstart these applications, no matter what your model organism is. MoClo...this blog, we will highlight some common MoClo applications and kits. Keep in mind that this technology ... it, MoClo might help you achieve it! MoClo applications and specialized tools Synthetic biology in bacteria...and multi-TU constructs for synthetic biology applications in bacteria or cell-free systems. The approach...

...Step 1. Steps 2 and 3 are usually very easy — our tech transfer team will communicate with your organization...species can be indicated in the “Species Other” column. Relevant Mutations Indicate the amino acid...name and match the name as it appears in its publication or as it is commonly known in your lab. Plasmid...descriptive purpose focuses on the practical application of the plasmid and will help a scientist outside...reagent/antibody, unspecified, or other. If other, indicate type in “Vector Type Other” column. For example...or room temperature. Growth Strain Please indicate which growth strain Addgene should propagate your...For plasmids that contain the R6Kγ origin of replication, choose the Pir1 strain. If your plasmid cannot...

... make it easy for your supervisor to support you. 3) Explain the problem and leave your emotions out of... series.  “The only healthy communication style is assertive communication.” - Jim Rohn, Author, Entrepreneur...I heard about supervisors in all of the above categories. In addition, I also learned about two other ...Assertiveness? An assertive person is able to communicate their ideas confidently while also considering...of the most frequent sources of conflict is miscommunication. For example, you might misunderstand your...the wrong direction. The best way to avoid miscommunication is to follow up after every meeting with an...workplace, these strategies will help you to communicate with confidence earn respect from your supervisor...