Skip to main content

We narrowed to 741 results for: REV

Showing: 461 - 480 of 741 results
  1. Antibodies 101: Validation

    Type
    Blog Post
    ... should review before using an antibody.  Antibodies and Reproducibility First, let’s review why validation...
  2. Which Fluorescence Microscopy Technique is Best for Me?

    Type
    Blog Post
    ...Single Molecule Localization (PALM/STORM), or Reversible Saturable Optical Linear Fluorescence Transitions.... Lens-based fluorescence nanoscopy. Quarterly reviews of biophysics 48, 178-243 (2015). PubMed PMID: ...
  3. Custom CRISPR Screens & the Green Listed Software

    Type
    Blog Post
    ...the original reference library, as well as GC%, reverse compliment sequences, and more. Output_Compact:...Wang, Tim, et al. "Gene essentiality profiling reveals gene networks and synthetic lethal interactions...
  4. Antibodies 101: Flow Cytometry

    Type
    Blog Post
    ...preparation, staining procedures, and controls. To prevent instrument clogs, ensure that samples are single... LA (1972) Fluorescence Activated Cell Sorting. Review of Scientific Instruments 43:404–409 . https://...
  5. Typing CRISPR Systems

    Type
    Blog Post
    ...evolutionary classification of CRISPR–Cas systems. Nature Reviews Microbiology, 13(11), 722–736. https://doi.org/... burst of class 2 and derived variants. Nature Reviews Microbiology, 18(2), 67–83. https://doi.org/10.1038...
  6. Antibodies 101: Designing Your First Flow Panel

    Type
    Blog Post
    ...excitation. After a short period, the electrons revert to a lower energy state, whereby a photon is emitted...markers they label) can occur. As I mentioned previously, you can also use fluorescent reporters, such...
  7. Live and Let Dye: Self-Labeling Protein Tags

    Type
    Blog Post
    ...super-resolution imaging of ER and mitochondria reveals dynamic organelle interactions. a) Labeling scheme...filament assembly-regulating proteins in vitro reveals complex events. a) Micrographs of a fluorescently-labeled...
  8. Protocol - How to Create a Bacterial Glycerol Stock

    Type
    Protocol
    ...addition of glycerol stabilizes the frozen bacteria, preventing damage to the cell membranes and keeping the ...stock on dry ice while streaking onto LB agar will prevent it from thawing completely and will improve the...
  9. Delivery Methods for Generating iPSCs

    Type
    Blog Post
    ... stem cells: reprogramming à la carte." Nature Reviews Genetics 12, no. 4 (2011): 231-42. PubMed PMID:...reference. 1. Malik, Nasir, and Mahendra S. Rao. "A Review of the Methods for Human iPSC Derivation." Methods...
  10. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16: Why does the PX260 ...D., Lin, C., Gootenberg, J. S., Konermann, S., Trevino, A. E., Scott, D. A., Inoue, A., Matoba, S., Zhang...
  11. Fluorescence Titering Assay

    Type
    Protocol
    ...Nalgene, 565-0010 (for viral preps, if prep was not previously filtered) Microcentrifuge tubes, Neptune 3745...expression using fluorescence microscopy. Last reviewed on: September 9, 2023...
  12. Lab Safety for Biosafety Levels One and Two

    Type
    Protocol
    ...in BSL-1, along with additional precautions to prevent injuries, ingestion, and exposures to hazardous... the work. Before working with chemicals, first review their material safety data sheets (MSDS). While...
  13. General Transfection

    Type
    Protocol
    ... time, allow them to mix and recheck the pH to prevent over or undershooting the desired pH. Allow the...panels) with a limited effect on cell growth. Last reviewed on: November 7, 2023...
  14. Protocol - How to Ligate Plasmid DNA

    Type
    Protocol
    ...insert will be added in the correct orientation and prevents the vector from ligating to itself during the ...phosphatase removes the 5' phosphate and therefore prevents the ligase from being able to fuse the two ends...
  15. Using a Light Microscope Protocol

    Type
    Protocol
    ...and the other holding the arm - or use a cart. Revolve the nosepiece so that the lowest power objective...your eyes away from the eyepiece and carefully revolve the nosepiece so that the next objective is in ...
  16. Pipetting Protocol

    Type
    Protocol
    ... needed to prevent contamination. When not in use, the tip box should be closed to prevent contamination...
  17. Pouring LB Agar Plates

    Type
    Protocol
    ...bottles. The extra empty volume is necessary to prevent your molten agar from boiling over in the autoclave...psi for at least 30 min. The high pressure will prevent your gel mix from boiling over at high temperature...
  18. 2022 Depositor Week

    Type
    Blog Post
    ...depositing their data with us through our newly revamped Data Hub! The community needs more data-sharing...
Showing: 461 - 480 of 741 results