Skip to main content
Addgene

We narrowed to 66 results for: REV

Showing: 1 - 20 of 66 results
  1. Lentivirus Plasmids

    Type
    Collection
    ...Generation Type Description PI 12253 pRSV-Rev 3rd Packaging Contains Rev; can be used with 3rd generation transfer...with a plasmid encoding Rev Trono 12260 psPAX2 2nd Packaging Contains Gag, Pol, Rev, and Tat; can be used...pCMV delta R8.2 2nd Packaging Contains Gag, Pol, Rev, and Tat; can be used with 2nd and 3rd generation...pCMV-dR8.2 dvpr 2nd Packaging Contains Gag, Pol, Rev, Tat, Vif, and Nef; can be used with 2nd and 3rd ...22500 pNHP 2nd Packaging Contains gag, pol, tat, rev Kasparov 1732 pCPRDEnv 2nd Packaging part of the ...the FELIX vector system, expresses Gag-Pol and Rev Nolan 35617 pCAG-Eco N/A Envelope Ecotropic MLV expressing...pCD/NL-BH*DDD 2nd Packaging Contains Gag/Pol, Tat, Rev. Use with envelope plasmids from Jakob Reiser. Reiser...
  2. p53 Pathway

    Type
    Collection
    ...suppression. Bieging KT, Mello SS, Attardi LD. Nat Rev Cancer. 2014 May;14(5):359-70. PubMed PMID: 24739573...from the mutant p53 field. Brosh R, Rotter V. Nat Rev Cancer. 2009 Oct;9(10):701-13. PubMed PMID: 19693097...p53 targets. Menendez D, Inga A, Resnick MA. Nat Rev Cancer. 2009 Oct;9(10):724-37. PubMed PMID: 19776742...
  3. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...AAV9 AAV-FLEX-rev-ChR2(H134R)-mCherry Scott Sternson AV-9-18917P 18917-AAV9 AAV-FLEX-rev-ChR2-tdtomato... James M. Wilson AV-1-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Optogenetics Scott Sternson AV-1-20071P...Addgene ID Name PI AV-1-18916P 18916-AAV1 AAV-FLEX-rev-ChR2(H134R)-mCherry Scott Sternson AV-1-20949P 20949...GENIE, Douglas Kim AV-10-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-10-PV1963 105542-... James M. Wilson AV-5-18917P 18917-AAV5 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-20071P 20071-AAV5...Pennsylvania Vector Core (Penn Vector Core) and Addgene previously partnered to provide high-quality AAV vectors...
  4. mTOR Pathway

    Type
    Collection
    ... L, Sonenberg N, Pelletier J, Topisirovic I. Nat Rev Drug Discov. 2015 Apr;14(4):261-78. doi: 10.1038/...
  5. Chemogenetics AAV Preps

    Type
    Collection
    ...none 1, 2, 5, 8, 9, rg* Roth 52536 rAAV-CAG::FLEX-rev:: hM4D-2a-GFP hM4D(Gi) - Inhibition GFP Cre-dependent...
  6. Viral Production

    Type
    Collection
    ...probes targeting integrated copies of the lentiviral Rev responsive element (RRE) gene and the cellular ribonuclease... et al. (2014) (Link opens in a new window) ). Previous experience suggests that titers obtained using...
  7. Ras Pathway

    Type
    Collection
    ...signalling pathways in cancer therapy. Downward J. Nat Rev Cancer. 2003 Jan;3(1):11-22. PubMed PMID: 12509763...
  8. Rett Syndrome

    Type
    Collection
    ...biological progress over 50 years in Rett syndrome. Nat Rev Neurol . 13, 37–51. PMID: 27934853 Neul et al. 2008...RNA trans-splicing, and protein replacement to reverse the impacts of this disease. Addgene is working...typically between 18 to 30 months, is regression of previously acquired skills, notably loss of acquired purposeful... demonstrates that Rett syndrome symptoms are reversible in mice if MECP2 gene expression is switched ... a new window) PMID: 24399845 Guy et al. 2007. Reversal of Neurological Defects in a Mouse Model of Rett...Laurvick et al. 2006. Rett syndrome in Australia: a review of the epidemiology. J Pediatric . 148(3):347-352...PMID: 18337588 Neul et al. 2010. Rett syndrome: revised diagnostic criteria and nomenclature. Ann Neurol...
  9. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...evolutionary classification of CRISPR-Cas systems. Nat Rev Microbiol . 13(11):722-36. PMID: 26411297 Mali P,...gRNA Design Tools CRISPR Blog Posts The CRISPR revolution shows no signs of slowing down. This prokaryotic...employ varied mechanisms to block CRISPR. Some prevent the CRISPR-Cas complex from binding to DNA. Others...or repressors can modulate transcription in a reversible manner. Epigenetics : dCas9 fused to epigenetic...Plants (monocots and dicots) C. elegans Yeast ( S. cerevisiae and S. pombe ) Zebrafish Xenopus References Barrangou...
  10. Validated gRNA Sequences

    Type
    Collection
    ... cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae GTTGAAAGTATTAGTTAAAG...70655 cut S. pyogenes 26472758 Sabatini CAN1 S. cerevisiae GATACGTTCTCTATGGAGGA 43803 cut S. pyogenes 23460208...interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate S. pyogenes...pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes 23977949...23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949 Lu CYC1m promoter... promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m promoter S. ...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate S. pyogenes...
  11. Brain Initiative Collection

    Type
    Collection
    ...pAAV-EF1a-iCreV can be used to generate AAV virus that will express light-inducible site-specific iCreV recombinase...pAAV-EF1a-iDreV can be used to generate AAV virus that will expresslight-inducible site-specific iDreV recombinase...Neurotechnologies® (BRAIN) Initiative aims to revolutionize our knowledge of the human brain through the... behavior. Long desired by researchers, the revolutionary dynamic picture of the brain generated through...will provide novel ways to treat, cure, and even prevent brain disorders. The BRAIN Initiative supports ...
  12. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...strand. Determine the reverse complement of each guide sequence. Example reverse complement sequences ...25-mer oligos for each guide and its associated reverse complement including additional nucleotides for...mer guide sequence and “AAAC” before the guide’s reverse complement for cloning into the pX330 vector using...the CACC sequence. Add a C at the 3’ end of the reverse complement oligo ( e.g., sgRNA-A in Table 4 ). ... and do not add C to the final position of the reverse complement oligo. In this case, the resultant oligos... intended deletion). Use a pair of forward and reverse primers flanking each sgRNA target site (within...Prepare a 10 μl reaction mix for each guide and its reverse complement: 1.0 μl sgRNA 24- or 25-mer oligo (100...
  13. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Khakh ATP FRET-based ATP sensor ATeam1.03-nD/nA Reversible dimerization of Aequorea victoria fluorescent...patterning of cGMP in vascular smooth muscle cells revealed by single GFP-linked biosensors. Proc Natl Acad...Peredox-mCherry in plants In Vivo NADH/NAD+ Biosensing Reveals the Dynamics of Cytosolic Redox Metabolism in Plants...for pyruvate A highly responsive pyruvate sensor reveals pathway-regulatory role of the mitochondrial pyruvate...pHluorin Two pathways of synaptic vesicle retrieval revealed by single-vesicle imaging. Neuron. 2009 Feb 12...macropinocytosis by lowering submembranous pH and preventing Rac1 and Cdc42 signaling. J Cell Biol. 2010 Feb...for pH sensing The zebrafish merovingian mutant reveals a role for pH regulation in hair cell toxicity ...
  14. Open Enzyme Collection

    Type
    Collection
    ...Ligases DNA Polymerases Restriction Endonucleases Reverse Transcriptases RNA Polymerases Other Enzymes You...DNA polymerases, RNA polymerases, DNA ligases, reverse transcriptases, and restriction enzymes. These ...reaction (PCR), cloning, isothermal amplification, reverse transcription of RNA into DNA, and dNTP synthesis...Ligases DNA Polymerases Restriction Endonucleases Reverse Transcriptases RNA Polymerases Other Enzymes DNA...pOpen-XbaIR XbaI 165568 pOpen-NcoIR NcoI Return to top Reverse Transcriptases Addgene ID Plasmid Gene/insert 165546...pOpen-MMLV_RT (mut H) Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase (RNAse H deactivated by 3 mutations... (lack H) Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase RNaseH - (lacking RNaseH domain) ...
  15. CRISPR Guide

    Type
    Collection
    ...the donor template, incorporating mutations that prevent further Cas9 cleavage will improve the accuracy... method in which Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) is fused to the C-terminus...the desired edit is incorporated into the DNA by reverse transcription. The edited DNA strand displaces ...editing. PASTE uses a CRISPR-Cas9n fused to both a reverse-transcriptase and a serine integrase (Bxb1), along...dCas9-mediated gene activation or repression is reversible, as it does not permanently modify the genomic...multiple fusions. The effects of CRISPRi/a may be reversible once the effector is inactivated or removed from... and even cell differentiation. The system is reversible, with a companion CRISPRon to undo repression...
  16. Caltech Systemic Capsids

    Type
    Collection
    ...140135 pAAV-EF1a-iCreV EF1a light-inducible recombinase iCreV Zeng 140136 pAAV-EF1a-iDreV EF1a light-inducible...strains. **AAV1-X1 has not been tested in rats. Abbreviations: AAV, adeno-associated virus; GRE, gene regulatory...check out Addgene's blog on Systemic Capsids . To review performance data of each of these serotypes, please...light-inducible recombinase iDreV Zeng 140137 pAAV-EF1a-iFlpV EF1a light-inducible recombinase iFlpV Zeng 164450...
  17. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...search and replace” gene editing method in which a reverse transcriptase (RT) is fused to the C terminus of...the desired edit is incorporated into the DNA by reverse transcription. The edited DNA strand displaces ... use the Moloney murine leukemia virus (M-MLV) reverse transcriptase. Engineering of the PE enzyme and...editing, including exploring new sources for the reverse transcriptase. Many PE enzymes and related tools...additional protection added to 3’ tail of pegRNA to prevent RNA degradation For more in-depth information on...
  18. Tetracycline Inducible Expression

    Type
    Collection
    ...most popular choices for rapid, efficient, and reversible control of gene expression in eukaryotes. To ...VP16 transcriptional activation domain); rtTA: reverse tetracycline-controlled transactivator (fusion ...tetracycline-dependent repression. Mutating these residues led to a reverse Tet repressor, or rTetR, which specifically binds...the TRE in the presence of tetracycline. A new reverse tetracycline-controlled transactivator (rtTA) was...TetR-tetO system, although the DNA-binding profile is reversed (Figure 1). However, rtTA can induce stronger ... marker. Aviv Regev , Joan Brugge Content last reviewed 20 June 2025. References Das, A. T., Tenenbaum...
  19. COVID-19 Resources

    Type
    Collection
    ...General Tools : Plasmids expressing Cas12a/Cas13a, Reverse Transcriptases, etc. that may be useful for detection...2020.06.23.166397 (Link opens in a new window) reverse transcriptase, protease, and Bst polymerase constructs...Enzymes. (unpublished) Taq polymerase and MMLV reverse transcriptase expression plasmids from the Drew...2020.03.29.013342 (Link opens in a new window) Reverse Transcriptase plasmids from Andrew Ellington's ...Plasmid form. If the plasmid has been described previously we will reach out to the lab to ask them to deposit...
  20. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ... vectors - PCR-based C-terminal tagging in S. cerevisiae pCS2FLAG - N- or C-terminal 2xFLAG...of proteins on the extracellular surface of S. cerevisiae cells His-tagged versions of pFastBac LIC vectors...Plasmids page pBF3060 - Metabolic engineering in S. cerevisiae TALENs Gene targeting TALEN kits - Construct ... and expression of bacterial gene clusters S. cerevisiae plasmids for multiple marker selection TRP1 Yeast...InvivoGen trademark. Return to top Content last reviewed 28 May 2025. Do you have suggestions for other...
Showing: 1 - 20 of 66 results