We narrowed to 4 results for: REV

... , pol , tat , and rev Two plasmids, one encoding gag/pol and another encoding rev Envelope Plasmid Interchangeable...nuclear export. RRE in cis Rev Response Element; the sequence to which the Rev protein binds. Psi (Ѱ) in...transcriptase and integrase components. rev in trans Binds to the Rev Response Element (RRE) within unspliced...additionally require the regulatory genes tat and rev , along with virus-specific accessory genes (for ...genes gag and pol , and regulatory genes tat and rev ; separated into two plasmids in third generation...Packaging plasmid — contains gag , pol , tat , and rev Envelope plasmid — contains env All second-generation...contains gag and pol Packaging plasmid 2 — contains rev Envelope plasmid — contains env Third-generation ...

...CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus Forward MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse...CCCGAAAAGTGCCACCTG 5' of MCS in pQE vectors Forward pQE rev CATTACTGGATCTATCAACAGGAG Lambda t0 terminator in ...GTATCACGAGGCCCTTTCG 5' of promoter in pQE vectors Forward QE-rev GTTCTGAGGTCATTACTGG Lambda t0 terminator in pQE vectors...CTGTTCCTGTACGGCATGG 3' end of tdTomato Forward tdTomato-Rev TCTTTGATGACGGCCATGT 5' end of tdTomato Reverse Tet-R...

...for Causal Cellular and Neuronal Biology. Physiol Rev, 98 (1), 391–418. https://doi.org/10.1152/physrev...modulation of signalling and neuronal activity. Nat Rev Methods Primers, 3 (1), 93. https://doi.org/10.1038...Chemogenetic tools to interrogate brain functions. Annu Rev Neurosci, 37 , 387–407. https://doi.org/10.1146/annurev-neuro...

...Optogenetics for light control of biological systems. Nat Rev Methods Primers, 2 , 55. https://doi.org/10.1038/...biophysics of microbial rhodopsins in neuroscience. Q Rev Biophys, 57 , e1. https://doi.org/10.1017/S0033583523000033...