Skip to main content

We narrowed to 15 results for: REV

Showing: 1 - 15 of 15 results
  1. Lentiviral Vector Guide

    Type
    Guide
    ... containing reverse transcriptase and integrase components. rev in trans Binds to the Rev Response Element... , pol , tat , and rev Two plasmids, one encoding gag/pol and another encoding rev Envelope Plasmid Interchangeable...nuclear export. RRE in cis Rev Response Element; the sequence to which the Rev protein binds. Psi (Ѱ) in...additionally require the regulatory genes tat and rev , along with virus-specific accessory genes (for ...genes gag and pol , and regulatory genes tat and rev ; separated into two plasmids in third generation...Packaging plasmid — contains gag , pol , tat , and rev Envelope plasmid — contains env All second-generation...contains gag and pol Packaging plasmid 2 — contains rev Envelope plasmid — contains env Third-generation ...
  2. Sequencing Primers

    Type
    Guide
    ...cell virus Forward MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse MT1-F GCTGTCCTCTAAGCGTCACC...tdTomato Forward tdTomato-Rev TCTTTGATGACGGCCATGT 5' end of tdTomato Reverse Tet-R GGCGAGTTTACGGGTTGTTA...' end of DsRed1 Reverse EBV Reverse GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward... pGP704 vector Reverse pHybLex Reverse GAGTCACTTTAAAATTTGTATACAC ADH terminator Reverse pLTet-F ACTGAGCACATCAGCAGGAC...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Reverse CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward CCCAGTCACGACGTTGTAAAACG...lacZ gene Foward M13/pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MSCV Forward CCCTTGAACCTCCTCGTTCGACC...virus Forward MSCV Reverse CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse pBABE 5' CTTTATCCAGCCCTCAC...
  3. Chemogenetics Guide

    Type
    Guide
    ...Neuronal Biology. Physiol Rev, 98 (1), 391–418. https://doi.org/10.1152/physrev.00009.2017 PMID: 29351511...brain functions. Annu Rev Neurosci, 37 , 387–407. https://doi.org/10.1146/annurev-neuro-071013-014048 PMID...alternatives for experiments. Perlapine has been previously used in human populations in Japan, making it...Bonci, A., & Michaelides, M. (2017). Chemogenetics revealed: DREADD occupancy and activation via converted...
  4. Optogenetics Guide

    Type
    Guide
    ...Optogenetics for light control of biological systems. Nat Rev Methods Primers, 2 , 55. https://doi.org/10.1038/...engineer new optobiology tools and improve upon previous tools through directed mutagenesis. Find optical... CIB1 450 LARIAT Inhibits protein function by reversibly sequestering targets into large, optically assembled...domain of Avena sativa phototropin 1 LOVETRAP reversibly sequester and release proteins from cellular ...protein that forms photolabile homodimers with slow reversal kinetics and a UV-B absorption profile 282 References...
  5. CRISPR Guide

    Type
    Guide
    ...the donor template, incorporating mutations that prevent further Cas9 cleavage will improve the accuracy... method in which Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) is fused to the C-terminus...the desired edit is incorporated into the DNA by reverse transcription. The edited DNA strand displaces ...editing. PASTE uses a CRISPR-Cas9n fused to both a reverse-transcriptase and a serine integrase (Bxb1), along...dCas9-mediated gene activation or repression is reversible, as it does not permanently modify the genomic...multiple fusions. The effects of CRISPRi/a may be reversible once the effector is inactivated or removed from... and even cell differentiation. The system is reversible, with a companion CRISPRon to undo repression...
  6. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...round of reverse transcription. After incorporation into a host cell, this deletion prevents further transcription...retroviruses is made of RNA. This retroviral RNA is reverse transcribed into DNA before being integrated in...genome of a host. Going from RNA to DNA is the reverse of what you would expect in biology — hence the...–11 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus, the cDNA that will...components. pol in trans Precursor protein containing reverse transcriptase and integrase components. Envelope...Engineered for safety and efficiency. Content last reviewed: 9 June 2025...
  7. Modular Cloning Guide

    Type
    Guide
    ...assembly of single and multi-gene constructs for S. cerevisiae expression. Multiplex Yeast Toolkit (MYT) Yeast...MoClo-YTK (Dueber) for genetic engineering of S. cerevisiae , enabling larger multi-gene constructs, multiplexed...transcription units for protein secretion in yeasts S. cerevisiae and P. pastoris (a.k.a. K. phaffii ). POMBOX ...the GoldenBraid system, for integration in S. cerevisiae . Easy-MISE Toolkit Yeast Expression Paola Branduardi...improved heterologous protein production in S. cerevisiae . MoClo Baculo Toolkit Yeast Expression, Insect...expression vectors for expression in baculovirus or S. cerevisiae . Compatible with MoClo-YTK , Bac-to-Bac, and...
  8. Adenovirus Guide

    Type
    Guide
    ...Genes over or under the line are in forward or reverse orientation, respectively. Created with BioRender.com...and Ad35 are also of interest for their low seroprevalence and greater ability to avoid vector-neutralizing...researchers if exposed. There is a risk of spontaneous reversion to RCAs, although this has been reduced by providing...2015). Adenovirus-vectored Ebola vaccines . Expert Review of Vaccines, 14 (10), 1347–1357. https://doi.org...and the adenoviral genes provided in trans . Seroprevalence Proportion of individuals within a population...virus can infect and replicate in. Content last reviewed: 9 June 2025...
  9. Promoters

    Type
    Guide
    ...proteins bind to negative-repressible operons and prevent transcription. When an inducer molecule binds to...to the repressor, it changes its conformation, preventing its binding to the operator and thus allowing...a repressor/corepressor binds to the operator preventing transcription. The trp operon involved in the...nucleosomes) also bind the TATA box. Histone binding prevents the initiation of transcription, whereas transcription... signals More Plasmids 101 topics Content last reviewed: 22 October 2025...
  10. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...provided by the chosen cell line to ensure safety and prevent the potential formation of replication-competent... M. A. (2003). From virus evolution to vector revolution: use of naturally occurring serotypes of adeno-associated...human genetic diseases . Cytokine & Growth Factor Reviews, 80 , 109–120. https://doi.org/10.1016/j.cytogfr... Blood-brain barrier (BBB) Layer of cells that prevent the entry of toxins and pathogens from the blood...virus can infect and replicate in. Content last reviewed: 9 June 2025...
  11. Antibody Guide

    Type
    Guide
    ...Description Configuration and Valency Subclasses IgA Prevalent antibody in secretions (e.g. tears, saliva, mucus... in the cell, and sample processing can hide or reveal epitopes on an antigen. Monoclonal antibodies only...block the membrane to remove excess antibody and prevent unwanted binding. Incubate the membrane with a ...should be run with: a positive control, a sample previously verified to contain your protein of interest ...interest, as described in the IP section above. Reverse the crosslink, isolate DNA, and perform downstream...
  12. Plan Your Experiment

    Type
    Guide
    ...RNA (pegRNA) Prime editor (Cas9 nickase fused to reverse transcriptase (RT)) Can edit within a wider window...the gRNA vector you have chosen, so it is best to review the protocol associated with the specific plasmid...doi.org/10.1038/nbt.3081 PMID: 25357182 Content last reviewed on 11 July 2025....
  13. Molecular Cloning Techniques

    Type
    Guide
    ... cleaved ends in the DNA fragments. Given its prevalence, the vast majority of plasmids used for DNA cloning...topics More Plasmids cloning topics Content last reviewed: 22 October 2025...
  14. Molecular Biology Reference

    Type
    Guide
    ...bases: adenine, thymine, cytosine, and guanine (abbreviated to A, T, C, and G, respectively). The bases are...the Addgene blog Addgene Protocols Content last reviewed: 22 October 2025...
Showing: 1 - 15 of 15 results