Skip to main content

We narrowed to 749 results for: REV;

Showing: 481 - 500 of 749 results
  1. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16: Why does the PX260 ...D., Lin, C., Gootenberg, J. S., Konermann, S., Trevino, A. E., Scott, D. A., Inoue, A., Matoba, S., Zhang...
  2. Fluorescence Titering Assay

    Type
    Protocol
    ...Nalgene, 565-0010 (for viral preps, if prep was not previously filtered) Microcentrifuge tubes, Neptune 3745...expression using fluorescence microscopy. Last reviewed on: September 9, 2023...
  3. Lab Safety for Biosafety Levels One and Two

    Type
    Protocol
    ...in BSL-1, along with additional precautions to prevent injuries, ingestion, and exposures to hazardous... the work. Before working with chemicals, first review their material safety data sheets (MSDS). While...
  4. General Transfection

    Type
    Protocol
    ... time, allow them to mix and recheck the pH to prevent over or undershooting the desired pH. Allow the...panels) with a limited effect on cell growth. Last reviewed on: November 7, 2023...
  5. Protocol - How to Ligate Plasmid DNA

    Type
    Protocol
    ...insert will be added in the correct orientation and prevents the vector from ligating to itself during the ...phosphatase removes the 5' phosphate and therefore prevents the ligase from being able to fuse the two ends...
  6. Using a Light Microscope Protocol

    Type
    Protocol
    ...and the other holding the arm - or use a cart. Revolve the nosepiece so that the lowest power objective...your eyes away from the eyepiece and carefully revolve the nosepiece so that the next objective is in ...
  7. Pipetting Protocol

    Type
    Protocol
    ... needed to prevent contamination. When not in use, the tip box should be closed to prevent contamination...
  8. Pouring LB Agar Plates

    Type
    Protocol
    ...bottles. The extra empty volume is necessary to prevent your molten agar from boiling over in the autoclave...psi for at least 30 min. The high pressure will prevent your gel mix from boiling over at high temperature...
  9. 2022 Depositor Week

    Type
    Blog Post
    ...depositing their data with us through our newly revamped Data Hub! The community needs more data-sharing...
  10. The 12 Days of CRISPR

    Type
    Blog Post
    ...Addgene gave to me: Functional Genetic Variants Revealed by Massively Parallel Precise Genome Editing (...
  11. Countdown to Halloween @Addgene

    Type
    Blog Post
    ...evidence was destroyed to protect the innocent revelers. Our Halloween costume contests have become an...
Showing: 481 - 500 of 749 results