We narrowed to 754 results for: REV;

...super-resolution imaging of ER and mitochondria reveals dynamic organelle interactions. a) Labeling scheme...filament assembly-regulating proteins in vitro reveals complex events. a) Micrographs of a fluorescently-labeled...

...the original reference library, as well as GC%, reverse compliment sequences, and more. Output_Compact:...Wang, Tim, et al. "Gene essentiality profiling reveals gene networks and synthetic lethal interactions...

...addition of glycerol stabilizes the frozen bacteria, preventing damage to the cell membranes and keeping the ...stock on dry ice while streaking onto LB agar will prevent it from thawing completely and will improve the...

... stem cells: reprogramming à la carte." Nature Reviews Genetics 12, no. 4 (2011): 231-42. PubMed PMID:...reference. 1. Malik, Nasir, and Mahendra S. Rao. "A Review of the Methods for Human iPSC Derivation." Methods...

...primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16: Why does the PX260 ...D., Lin, C., Gootenberg, J. S., Konermann, S., Trevino, A. E., Scott, D. A., Inoue, A., Matoba, S., Zhang...

...expression of a catalytically dead Cas9 enzyme allows reversible repression based on the presence of the inducer...modulation. CRISPRa from sigma-54 promoters Noting that previous work in bacterial CRISPRa had focused on sigma...

...Nalgene, 565-0010 (for viral preps, if prep was not previously filtered) Microcentrifuge tubes, Neptune 3745...expression using fluorescence microscopy. Last reviewed on: September 9, 2023...

...in BSL-1, along with additional precautions to prevent injuries, ingestion, and exposures to hazardous... the work. Before working with chemicals, first review their material safety data sheets (MSDS). While...

... time, allow them to mix and recheck the pH to prevent over or undershooting the desired pH. Allow the...panels) with a limited effect on cell growth. Last reviewed on: November 7, 2023...

...insert will be added in the correct orientation and prevents the vector from ligating to itself during the ...phosphatase removes the 5' phosphate and therefore prevents the ligase from being able to fuse the two ends...

...and the other holding the arm - or use a cart. Revolve the nosepiece so that the lowest power objective...your eyes away from the eyepiece and carefully revolve the nosepiece so that the next objective is in ...

... needed to prevent contamination. When not in use, the tip box should be closed to prevent contamination...

...bottles. The extra empty volume is necessary to prevent your molten agar from boiling over in the autoclave...psi for at least 30 min. The high pressure will prevent your gel mix from boiling over at high temperature...

...depositing their data with us through our newly revamped Data Hub! The community needs more data-sharing...

...Addgene gave to me: Functional Genetic Variants Revealed by Massively Parallel Precise Genome Editing (...

...away from the functionality and features that previously made the platform a mainstay of conversation ...

...on CRISPR and synBio plasmid sharing In a recent review on CRISPR technology, for example, the authors ...

..., the Phuels lab deposited a plasmid that will forever change the fly lab experience. The Frequency Light...

...promoter, or tool type. Drilling into any entry will reveal additional data including the subject’s age at ...

...evolving, but sometimes a technology is so useful it forever enhances biological research and discovery. CRISPR...