We narrowed to 734 results for: son

1. Plasmids 101: What is a plasmid?

   Type

   Blog Post

   ...restriction enzyme, ligation independent, Gateway, Gibson, etc). The cloning method is ultimately chosen ...

2. Bringing Sustainable Practices to the Lab: Recycling

   Type

   Blog Post

   ...easy to spot and even easier to ship back. Be that person! If you use serological pipettes from Corning...

3. SunTag and Fluorescent Imaging

   Type

   Blog Post

   ...the Vale and Weissman labs took this biological lesson and created a system to amplify fluorescent signals...

4. Tips for Improving Your Next Manuscript

   Type

   Blog Post

   ...practical understanding of how to apply it. The personal interaction of critiquing others’ manuscripts ...

5. FastCloning: A Newer, Simpler Cloning Technique

   Type

   Blog Post

   ...tips for applying it in your own lab. Table 1: Comparison Between Standard Restriction Cloning and Fast...

6. Walking beside Academia and giving it a high five: My transition from graduate work to a position at Addgene

   Type

   Blog Post

   ...months down the line!) and to visit scientists in person to figure out ways we can make Addgene better and...

7. Addgene @ Keystone: Thoughts on Precision Genome Engineering and Synbio

   Type

   Blog Post

   ...found myself extremely grateful to my colleague Jason for choosing Simon Singh's "The Code Book" for this...

8. Choosing Your Perfect Empty Backbone

   Type

   Blog Post

   ... Lianna Swanson...

9. Advice for Choosing a Research Project

   Type

   Blog Post

   ...has multiple benchmarks. Think about what your personal goals are and set milestones along the way so ...

10. History of CRISPR Cas - A tale of survival and evolution

    Type

    Blog Post

    ...467-477. Bondy-Denomy J, Pawluk A, Maxwell KL, Davidson AR.  Nature. 2013 Jan; 493, 429–432. Cong L,...

11. Sequencing Primers

    Type

    Guide

    ...Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC (Invitrogen) ...primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial transposon Tn7 TRC-F CAAGGCTGTTAGAGAGATAATTGGA (Root lab...

12. Hot Plasmids - June 2020 - Barcoded CRISPR Library, Sparse Cell Labeling, Calcineurin Reporter, and DNA Staining Dye Alternative

    Type

    Blog Post

    ...purification of tTALE-eGFP and tTALE-mCherry. In comparison to intercalating fluorescent dyes which can cause...

13. Viral Genome Sequencing - A One Stop Shop for AAV Identity and Serotype Confirmation

    Type

    Blog Post

    ...strands that are packaged at the same frequency, we reasoned that, following DNA extraction, the [+] and [-...

14. Antibodies 101: Epitope Availability

    Type

    Blog Post

    ... Rachel Leeson...

15. Hot Plasmids and Viral Preps - September 2021

    Type

    Blog Post

    ...stop codons.    New from the viral service By Jason Nasse We regularly add new viral aliquots from our...

16. Three Tips for Preventing Viral Plasmid Recombination in Your Samples

    Type

    Blog Post

    ...recombination in samples. For a more detailed comparison of these cloning strains, browse the table of...

17. Scientific Peer-review: Providing Critical and Kind Feedback and Advocating for Open Science

    Type

    Blog Post

    ...she will start her own research group at Boyce Tompson Institute.  References Baldwin, Melinda. "Credibility...

18. Bright Monomeric Fluorescent Proteins: mNeonGreen, mTFP1, and mWasabi

    Type

    Blog Post

    ...Resources on Addgene.org Learn about the Michael Davidson fluorescent protein collection Check out Addgene...

19. Multifunctional Neural Fibers: Modulation from Gut to Brain

    Type

    Blog Post

    ...the gut-brain axis (admittedly for self-serving reasons – I want to understand my obsession with the combination...

20. Viral Vectors 101: What is a Virus (and a Viral Vector)?

    Type

    Blog Post

    ... Rachel Leeson...