...Amrani N, Chen JS, Cofsky JC, Kranzusch PJ, Sontheimer EJ, Davidson AR, Maxwell KL, Doudna JA. Cell . Sep 7...Hidalgo-Reyes Y, Lee J, Edraki A, Shah M, Sontheimer EJ, Maxwell KL, Davidson AR. Cell . 167(7):1829-1838. PMID...generally low (<10% of modified alleles). For this reason, many laboratories try to enhance HDR by synchronizing...Tu LC, Naseri A, Chung YC, Grunwald D, Zhang S, Pederson T.. Nat Methods . Nov;15(11):928-931. PMID: 30377374... Lamribet K, Dardillac E, Boix C, Perrouault L, Tesson L, Geny S, De Cian A, Itier JM, Anegon I, Lopez...genetic screens with multiple modalities. 2018. Sanson KR, Hanna RE, Hegde M, Donovan KF, Strand C, Sullender...Li M, Zhou F, Li K, Cao H, Ni M, Liu Y, Gu Z, Dickerson KE, Xie S, Hon GC, Xuan Z, Zhang MQ, Shao Z, Xu...

...back by the 5' exonuclease. Gibson Assembly (Image from Plasmid 101: Gibson Assembly ) Back to Top Type...Engineering Guide Restriction Enzyme Gateway TOPO Gibson Type IIS Ligation Independent Cloning Oligo Stitching...cost, availability of starting materials or just personal preference. Check out our blog on choosing the... is the "classic" cloning method, and for many reasons, remains one of the most popular today. Restriction...Plasmid 101 blog post on TOPO cloning. Back to Top Gibson Assembly (Isothermal Assembly Reaction) Isothermal...Isothermal cloning, more commonly known as Gibson assembly ( protocol ), takes advantage of the properties ...lastly DNA ligase fuses DNA strands together. In Gibson assembly DNA fragments with 20-40 base pair homology...

...t/t), ChrimsonR Red-shifted peak action spectra Examples: VChR1, C1V1(t/t), Chrimson, ChrimsonR, Chronos...helveticum 500 Chrimson, ChrimsonR Red-light drivable channel from Chlamydomonas noctigama . ChrimsonR carries...research, helping scientists to better understand Parkinson’s disease, depression, drug addiction, and more...Ramakrishnan C, Mattis J, Prakash R, Diester I, Goshen I, Thompson KR, Deisseroth K. 2010 Molecular and cellular ...Klapoetke NC, Murata Y, Kim SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ...Methods. 9(2):159-72. PMID 22179551 Saunders A, Johnson CA, Sabatini BL 2012. Novel recombinant adeno-associated...21363959 Yizhar O, Fenno LE, Prigge M, Schneider F, Davidson TJ, O'Shea DJ, Sohal VS, Goshen I, Finkelstein...

...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...may need additional processing steps, such as sonication. Denature proteins, using heat and/or chemicals...housekeeping genes). This allows for relative comparison of expression between different samples, by normalizing...normalizing protein expression to the controls before comparison. Alternatively, the samples can be normalized...ChIP protocols use enzyme digestion instead of sonication. This approach is gentler but results in non-...isolated and analyzed. Validation relies on size comparison of peptides. Independent antibody validation ...

...receptors. Neuron 63:27–39. PMID: 19607790 Atasoy D, Sternson SM (2018). Chemogenetic Tools for Causal Cellular...Magnus CJ, Lee PH, Atasoy D, Su HH, Looger LL, and Sternson SM (2011). Chemical and genetic engineering of...Ramirez MH, Hu X, Galvan A, Basu J, Michaelides M, Sternson SM (2019). Ultrapotent chemogenetics for research...therapy. J Biol Chem. 276:1596-6. PMID: 11402033 Sternson SM, Roth BL (2014). Chemogenetic tools to interrogate...J. Biol. Chem. 266:5–8. PMID: 1670767 Vardy E, Robinson JE, Li C, Olsen RHJ, DiBerto JF, et al (2015).... Xiong M, Tao Y, Gao Q, Feng B, Yan W, Zhou Y, Kotsonis TA, Yuan T, You Z, Wu Z, Xi J, Haberman A, Graham...

...Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC (Invitrogen) ...primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial transposon Tn7 TRC-F CAAGGCTGTTAGAGAGATAATTGGA (Root lab...

...plasmids are based on the HIV-1 virus. For safety reasons, transfer plasmids are all replication incompetent...generation or 3rd generation packaging system. For a comparison of the key differences between the 2nd and 3rd...

...trans-splicing or overlapping vectors: a quantitative comparison. Duan D, Yue Y, Engelhardt JF. Mol Ther. 2001...

...essential tool in molecular biology for a variety of reasons, including that they are: Easy to work with - Plasmids...