Skip to main content
Addgene

We narrowed to 12 results for: son

Showing: 1 - 12 of 12 results
  1. CRISPR Guide

    Type
    Guide
    ... A., Chan, M. M., Bauer, D. E., Marson, A., Parsons, L. R., & Adamson, B. (2024). Improving prime editing...including transposons, integrases, and recombinases, with Cas enzymes. CRISPR Transposases Transposon systems...I., Yoon, Y., Song, C., Cao, Y., Gallant, J., Xue, W., Rivera-Pérez, J. A., & Sontheimer, E. J. (2019)...S., Cofsky, J. C., Kranzusch, P. J., Sontheimer, E. J., Davidson, A. R., Maxwell, K. L., & Doudna, J. ..., J., Edraki, A., Shah, M., Sontheimer, E. J., Maxwell, K. L., & Davidson, A. R. (2016). Naturally occurring... Chen, C., Nelson, J. W., Newby, G. A., Sahin, M., Osborn, M. J., Weissman, J. S., Adamson, B., & Liu,...Ramadoss, G. N., Shi, Q., Hung, K. L., Samelson, A. J., Pogson, A. N., Kim, J. Y., Chung, A., Leonetti...
  2. Cloning

    Type
    Guide
    ...back by the 5' exonuclease. Gibson Assembly (Image from Plasmid 101: Gibson Assembly ) Back to Top Type...Engineering Guide Restriction Enzyme Gateway TOPO Gibson Type IIS Ligation Independent Cloning Oligo Stitching...cost, availability of starting materials or just personal preference. Check out our blog on choosing the... is the "classic" cloning method, and for many reasons, remains one of the most popular today. Restriction...Plasmid 101 blog post on TOPO cloning. Back to Top Gibson Assembly (Isothermal Assembly Reaction) Isothermal...Isothermal cloning, more commonly known as Gibson assembly ( protocol ), takes advantage of the properties ...lastly DNA ligase fuses DNA strands together. In Gibson assembly DNA fragments with 20-40 base pair homology...
  3. Optogenetics Guide

    Type
    Guide
    ...t/t), ChrimsonR Red-shifted peak action spectra Examples: VChR1, C1V1(t/t), Chrimson, ChrimsonR, Chronos...helveticum 500 Chrimson, ChrimsonR Red-light drivable channel from Chlamydomonas noctigama . ChrimsonR carries...research, helping scientists to better understand Parkinson’s disease, depression, drug addiction, and more...Ramakrishnan C, Mattis J, Prakash R, Diester I, Goshen I, Thompson KR, Deisseroth K. 2010 Molecular and cellular ...Klapoetke NC, Murata Y, Kim SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ...Methods. 9(2):159-72. PMID 22179551 Saunders A, Johnson CA, Sabatini BL 2012. Novel recombinant adeno-associated...21363959 Yizhar O, Fenno LE, Prigge M, Schneider F, Davidson TJ, O'Shea DJ, Sohal VS, Goshen I, Finkelstein...
  4. Antibody Guide

    Type
    Guide
    ...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...may need additional processing steps, such as sonication. Denature proteins, using heat and/or chemicals...housekeeping genes). This allows for relative comparison of expression between different samples, by normalizing...normalizing protein expression to the controls before comparison. Alternatively, the samples can be normalized...ChIP protocols use enzyme digestion instead of sonication. This approach is gentler but results in non-...isolated and analyzed. Validation relies on size comparison of peptides. Independent antibody validation ...
  5. Chemogenetics Guide

    Type
    Guide
    ...19607790 (Link opens in a new window) Atasoy D, Sternson SM (2018). Chemogenetic Tools for Causal Cellular...Magnus CJ, Lee PH, Atasoy D, Su HH, Looger LL, and Sternson SM (2011). Chemical and genetic engineering of...Ramirez MH, Hu X, Galvan A, Basu J, Michaelides M, Sternson SM (2019). Ultrapotent chemogenetics for research...6. PMID: 11402033 (Link opens in a new window) Sternson SM, Roth BL (2014). Chemogenetic tools to interrogate...26399324 (Link opens in a new window) Vardy E, Robinson JE, Li C, Olsen RHJ, DiBerto JF, et al. (2015)... Xiong M, Tao Y, Gao Q, Feng B, Yan W, Zhou Y, Kotsonis TA, Yuan T, You Z, Wu Z, Xi J, Haberman A, Graham...
  6. Adenovirus Guide

    Type
    Guide
    ... cloning methods, including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may... Bullard, B. L., Corder, B. N., Gordon, D. N., Pierson, T. C., & Weaver, E. A. (2020). Characterization...Asiedu, C., Geisbert, J., Stanley, D., Honko, A., Johnson, J., Mulangu, S., Pau, M. G., Custers, J., Vellinga...gene and cell-based therapies in the new era of personalized medicine . Genes & Diseases, 4 (2), 43–63. https...window) Luo, J., Deng, Z. L., Luo, X., Tang, N., Song, W. X., Chen, J., Sharff, K. A., Luu, H. H., Haydon...
  7. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... cloning methods, including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may...Ravin, S. S., Su, L., Theobald, N., Choi, U., Macpherson, J. L., Poidinger, M., Symonds, G., Pond, S. ...Ridder, J., Allahyar, A., Wang, W., Carpenter, E., Mason, A., Wong, G. K., Cameron, E. R., Kilbey, A., & ...Srivastava, S., Hussain, R., Banani, M. A., Day, W., Stevenson, E., Madigan, M., Chen, J., Khinder, R., . . ....
  8. Lentiviral Vector Guide

    Type
    Guide
    ...third-generation packaging plasmids. For a summarized comparison of second- and third-generation systems, please... cloning methods, including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may...doi.org/10.1016/j.biopha.2020.110276 PMID: 32502836 Johnson, N. M., Alvarado, A. F., Moffatt, T. N., Edavettal...
  9. Sequencing Primers

    Type
    Guide
    ...Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC (Invitrogen) ...primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial transposon Tn7 TRC-F CAAGGCTGTTAGAGAGATAATTGGA (Root lab...
  10. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... cloning methods, including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may...trans-splicing or overlapping vectors: a quantitative comparison . Molecular Therapy, 4 (4), 383–391. https://...
  11. Plan Your Experiment

    Type
    Guide
    ...Reports . 5 , 11315. PMID: 26066060 Zuris, J. A., Thompson, D. B., Shu, Y., Guilinger, J. P., Bessen, J. ...
  12. Molecular Biology Reference

    Type
    Guide
    ...essential tool in molecular biology for a variety of reasons, including that they are: Easy to work with - Plasmids...
Showing: 1 - 12 of 12 results