Skip to main content
Addgene

We narrowed to 68 results for: son

Showing: 1 - 20 of 68 results
  1. Michael Davidson Fluorescent Protein Collection

    Type
    Collection
    ...Proteins Michael Davidson Fluorescent Protein Collection Michael Davidson Fluorescent Protein Collection...Davidson lab fluorescent protein fusion constructs and backbones. Plasmid...Subcellular localization Optogenetics The lab of Michael Davidson from Florida State University has contributed ...localization data found below. In addition, the Davidson lab has contributed the corresponding empty backbone...with your gene of interest. Please visit Michael Davidson's Molecular Expressions website for additional ...
  2. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Nucleolus (fibrillar center) 133964 SON-mEGFP AICSDP-82 mEGFP SON Nuclear speckles 159744 DMD-mEGFP AICSDP..., Tucker A, Grancharova T, Arakaki J, Fuqua MA, Nelson A, Hookway C, Ludmann SA, Mueller IA, Yang R, Horwitz...
  3. Immunology Research Plasmids and Resources

    Type
    Collection
    ...RaLP, SHCD SOS1 son of sevenless homolog 1 (Drosophila) GF1, GGF1, GINGF, HGF, NS4 SOS2 son of sevenless ... RHOH12 SOS1 son of sevenless homolog 1 (Drosophila) GF1, GGF1, GINGF, HGF, NS4 SOS2 son of sevenless ...Set : From Jesse Boehm , William Hahn , Matthew Meyerson , and David Root , this kit consists of 182 wild-type..., Hu Z, Zalocusky KA, Shankar RD, Shen-Orr SS, Thomson E, Wiser J, Butte AJ. 2018. ImmPort, toward repurposing...
  4. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's Mark Cookson 13315 ...CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13318...CMV Parkinson's Mark Cookson 13319 pLenti6-DEST PINK1-V5 KD PINK1 V5 CMV Parkinson's Mark Cookson 13320...V5 CMV Parkinson's Mark Cookson 13321 pGEX5X.1 PINK1 WT PINK1 GST tac Parkinson's Mark Cookson 13322 pGEX5X...His, Myc CMV Parkinson's Ted Dawson 17612 pRK5-Myc-Parkin PRKN Myc CMV Parkinson's Ted Dawson 17613 pRK5...GFP CMV Parkinson's Mark Cookson 25045 pDEST53-LRRK2-G2019S LRRK2 GFP CMV Parkinson's Mark Cookson 25046...GFP CMV Parkinson's Mark Cookson 25048 pDEST53-LRRK2-Y1699C LRRK2 GFP CMV Parkinson's Mark Cookson 25049...
  5. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... James M. Wilson AV-1-PV0105 105532-AAV1 pAAV.CMV.ffLuciferase.SV40 Control James M. Wilson AV-1-PV1917...James M. Wilson AV-1-PV1963 105542-AAV1 pENN.AAV.CB7.CI.eGFP.WPRE.rBG Control James M. Wilson AV-1-PV2177...James M. Wilson AV-1-PV2642 105552-AAV1 pENN.AAV.hSyn.TurboRFP.WPRE.RBG Control James M. Wilson AV-1-PV2975...Control James M. Wilson AV-2-PV0101 105530-AAV2 pAAV.CMV.PI.EGFP.WPRE.bGH Control James M. Wilson AV-2-PV1963...Control James M. Wilson AV-5-PV0102 105531-AAV5 pAAV.CMV.LacZ.bGH Control James M. Wilson AV-5-PV1917 105541...James M. Wilson AV-5-PV1963 105542-AAV5 pENN.AAV.CB7.CI.eGFP.WPRE.rBG Control James M. Wilson AV-5-PV2177... James M. Wilson AV-5-PV2213 105547-AAV5 pENN.AAV.EF1a.eGFP.WPRE.rBG Control James M. Wilson AV-5-PV2369...
  6. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...* Michael Davidson 54491 mCherry-Lifeact-7 Actin Filaments LifeAct mCherry* Michael Davidson 54610 mEGFP-Lifeact...Michael Davidson 55148 mCherry-Tubulin-C-18 Microtubules alpha-tubulin mCherry* Michael Davidson 12298 ...Michael Davidson 55165 mCherry-ZO1-C-14 Tight Junctions Zonula Occludens-1 mCherry Michael Davidson 55001...TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagBFP James Johnson 13050 DsRed-Rab5... 38770 pEF.myc.ER-E2-Crimson Endoplasmic Reticulum ER retention signal E2-Crimson Benjamin Glick 36204... James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc...TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagBFP James Johnson 12674 GFP-rab11...
  7. CRISPR Guide

    Type
    Collection
    ... A., Chan, M. M., Bauer, D. E., Marson, A., Parsons, L. R., & Adamson, B. (2024). Improving prime editing...including transposons, integrases, and recombinases, with Cas enzymes. CRISPR Transposases Transposon systems...I., Yoon, Y., Song, C., Cao, Y., Gallant, J., Xue, W., Rivera-Pérez, J. A., & Sontheimer, E. J. (2019)...S., Cofsky, J. C., Kranzusch, P. J., Sontheimer, E. J., Davidson, A. R., Maxwell, K. L., & Doudna, J. ..., J., Edraki, A., Shah, M., Sontheimer, E. J., Maxwell, K. L., & Davidson, A. R. (2016). Naturally occurring... Chen, C., Nelson, J. W., Newby, G. A., Sahin, M., Osborn, M. J., Weissman, J. S., Adamson, B., & Liu,...Ramadoss, G. N., Shi, Q., Hung, K. L., Samelson, A. J., Pogson, A. N., Kim, J. Y., Chung, A., Leonetti...
  8. Optogenetics AAV Preps

    Type
    Collection
    ...Constitutive 1, 5, rg* Boyden 59171 pAAV-Syn-ChrimsonR-tdT Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden ...Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ChrimsonR tdTomato Cre dependent 1, 5 Boyden 130909 AAV-CAG-FLPX-rc... AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato Flp dependent 8 Boyden 100049 pAAV.hSynap.ChETA...9 Deisseroth 105448 pAAV-hSyn-DIO-ChrimsonR-mRuby2-ST Syn ChrimsonR (soma-targeted) mRuby2 Cre dependent...Adesnik 124603 pAAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 EF1a ChrimsonR (soma-targeted) mRuby2 Cre ...9 Adesnik 124651 pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 CaMKII ChrimsonR (soma-targeted) mScarlet Constitutive... Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1, 9 Jensen...
  9. Control AAV Preps

    Type
    Collection
    ..., 9, rh10, PHP.eB Wilson 105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 5, 8 Wilson 105532 pAAV.CMV.ffLuciferase.SV40...ffLuciferase Constitutive 8 Wilson 105536 pAAV.TBG.PI.Null.bGH TBG none Constitutive 8 Wilson 105541 pENN.AAV.CamKII0.4...Constitutive 1, 5 Wilson 105535 pAAV.TBG.PI.eGFP.WPRE.bGH TBG EGFP Constitutive 8 Wilson 105542 pENN.AAV.CB7..., 2, 5, 8, 9 Wilson 105543 pENN.AAV.cTNT.PI.eGFP.WPRE.rBG cTNT EGFP Constitutive 9 Wilson 105544 pENN...., PHP.eB Wilson 105548 pENN.AAV.CMVs.TurboRFP.WPRE.RBG CMV TurboRFP Constitutive 1, 8 Wilson 105549 pAAV.GFAP.eGFP.WPRE.hGH...Constitutive 5 Wilson 105552 pENN.AAV.hSyn.TurboRFP.WPRE.RBG hSyn TurboRFP Constitutive 1 Wilson 105556 pENN.AAV.tMCK.PI.eGFP.WPRE.bGH...Constitutive 9 Wilson 105557 pENN.AAV.CB7.CI.mCerulean.WPRE.RBG CB7 mCerulean Constitutive 1, 9 Wilson 105598 ...
  10. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...meningitidis Thomson pSmart-Nm-sgRNA-BbsI 49157 Mammalian U6 none N. meningitidis Thomson pXCas9H840A ...pyogenes Pederson pLH-nmsgRNA1.1 64115 Mammalian/Lentiviral U6 none N. meningitidis Pederson pLH-stsgRNA1.1...meningitidis Pederson pLH-stsgRNA2.1 64117 Mammalian/Lentiviral U6 none N. meningitidis Pederson pLH-stsgRNA3.1... Herold lentiGuide-Crimson 70683 Mammalian/Lentiviral hU6 none S. pyogenes Crimson Bauer BPK2660 70709...pyogenes EGFP Jackson AIO-mCherry 74120 Mammalian U6x2 yes, nick S. pyogenes mCherry Jackson pMZ376 74213...Drosophila BbsI none S. pyogenes O'Connor-Giles, Harrison, Wildonger gRNA_Cloning Vector 41824 Mammalian...Worm BsaI none S. pyogenes Boxem pIK198 65629 Worm Gibson none S. pyogenes Katic pHKMC1: Empty sgRNA for ...
  11. Cre-lox system

    Type
    Collection
    ...Cre CMV AAV Wilson 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 EGFP-Cre fusion hSyn AAV Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40...EGFP-Cre fusion CMV AAV Wilson 105550 pAAV.GFAP.Cre.WPRE.hGH Cre GFAP AAV Wilson 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40...GFP-Cre fusion CamKII AAV Wilson 105553 pENN.AAV.hSyn.Cre.WPRE.hGH Cre hSyn AAV Wilson 105555 pENN.AAV.hSyn.Cre.hGH...pENN.AAV.hSyn.Cre.hGH Cre hSyn AAV Wilson 105558 pENN.AAV.CamKII 0.4.Cre.SV40 Cre CamKII AAV Wilson 105603 pAAV.GfaABC1D.PI.Cre.SV40...Khakh 105869 pEMS1925 iCre-ERT2 Simpson 105870 pEMS1725 iCre-ERT2 Simpson 106368 pCMV-Tag2B-NCre N-terminal...AAV.TBG.PI.Cre.rBG Cre TBG AAV Wilson 107788 AAV.rTH.PI.Cre.SV40 Cre rTH AAV Wilson 108454 mCherry-p2A-CreERT2...recombination has occurred, allowing for direct comparison of Cre+ and Cre- cells. While Cre-lox recombination...
  12. Recombinases AAV Preps

    Type
    Collection
    ...CamKII GFP 9, rg* Wilson 105558 pENN.AAV.CamKII 0.4.Cre.SV40 CamKII none 1, 5, 9, rg* Wilson 105537 pENN.AAV.CMVs.Pl.Cre.rBG...5, 8, 9, rh10 Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre..., rg*, PHPeB Wilson 105553 pENN.AAV.hSyn.Cre.WPRE.hGH Syn none 1, 2, 5, 8, 9, rg* Wilson 105555 pENN.AAV.hSyn.Cre.hGH...105550 pAAV.GFAP.Cre.WPRE.hGH GFAP none 5, PHPeB Wilson 196410 AAV-GfaABC1D-Cre-4x6T GfaABC1D none 5 Carmichael...Carmichael 107788 AAV.rTH.PI.Cre.SV40 rTH none 9, rg* Wilson 24593 AAV-pgk-Cre PGK none rg* Aebischer 51507 ....AAV.hSyn.Cre.hGH Syn none 9 Wilson 107312 AAV-hSyn-mCherry-P2A-Cre-WPRE Syn mCherry 1 Yang 107738 pAAV-hSyn-Cre-P2A-dTomato...PHPeB Larsen 107787 AAV.TBG.PI.Cre.rBGe TBG none 8 Wilson Dre AAV ID Name Promoter Fluorophore Serotype(s...
  13. Bacterial Expression Systems

    Type
    Collection
    ...acceptor) FRET Robert Campbell , Michael Davidson Michael Davidson , Nathan Shaner , Roger Tsien 54575 54771...Timers Return to top Protein Interactions Förster resonance energy transfer (FRET) and bimolecular fluorescence...acceptor) FRET/Dual FRET Robert Campbell Michael Davidson , Nathan Shaner , Roger Tsien 54553 54723 mTFP1...acceptor) FRET/Dual FRET Robert Campbell , Michael Davidson 54571 54856 mT-Sapphire-pBAD tdTomato-pBAD mT-... Clover (donor) mRuby2 (acceptor) FRET Michael Davidson 18856 pGWF1 ECFP (donor) Venus (acceptor) FRET...IPTG Escherichia coli , Acinetobacter baumannii Jason Peters 127088 pMS17 tcp830 Anhydrotetracycline (... (firefly luciferase) Mycobacterium sp. Brian Robertson , Siouxsie Wiles 26161 pMV306hsp+LuxG13 Promoter...
  14. Validated gRNA Sequences

    Type
    Collection
    ...23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer...Guigo, Johnson GFPmut3b synthetic ACCATCTAATTCAACAAGAATT 73224 interfere S. pyogenes 26689101 Hudson xylR...ACCATCTAATTCAACAAGAATT 73221 interfere S. pyogenes 26689101 Hudson pgi C. glutamicum TGACCGATCATTACTCAAACTTCC 74066...CAGAACACCCCCATCGGCGA 72619 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAACCGGTGGGGCTGCGTCA; ...GGCAGGAGAGGCCAGTTGCG 72620 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GCAACTTCCATTTTCAGTCT; ...GGAAGCCTCAGCTCGCCTGA 72621 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GCTGGGGCTCAGTTGCGTAA; gRNA2...AGGTTTCTAAAACATGACGG 72622 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GTTGAGATGAAGCTTCTTCA; gRNA2...
  15. Brain Initiative Collection

    Type
    Collection
    ...105448-AAV9 pAAV-hSyn-DIO-ChrimsonR-mRuby2-ST Cation channelrhodopsin ChrimsonR fused to mRuby2 fluorophore...pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST Cre dependent co-expression of jGCaMP8s and soma-targeted ChrimsonR under the ...pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE Expresses bicistronically soma-targeted ChrimsonR in frame...Chemogenetics Cre-dependent expression plasmid Scott Sternson 119741-AAV9 AAV SYN flex PSAM4 GlyR IRES EGFP ...Chemogenetics Cre-dependent expression plasmid Scott Sternson 119742-AAV5 AAV SYN PSAM4 GlyR IRES EGFP Chemogenetics...Chemogenetics expression plasmid Scott Sternson 119744-AAV5 AAV CAMKII PSAM4 GlyR IRES EGFP Chemogenetics...
  16. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...Hidalgo-Reyes Y, Lee J, Edraki A, Shah M, Sontheimer EJ, Maxwell KL, Davidson AR. 2016. Naturally occurring off-switches...MF, Hidalgo-Reyes Y, Wiedenheft B, Maxwell KL, Davidson AR. 2015. Multiple mechanisms for CRISPR-Cas inhibition...26416740 Bondy-Denomy J, Pawluk A, Maxwell KL, Davidson AR. 2013. Bacteriophage genes that inactivate ...132-6. PMID: 23942116 Gilbert LA, Horlbeck MA, Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes...Cell . 159(3):647-6. PMID: 25307932 Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-...Topkar VV, Nguyen NT, Zheng Z, Gonzales AP, Li Z, Peterson RT, Yeh JR, Aryee MJ, Joung JK. 2015. Engineered...Naseri A, Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. 2015. Multicolor CRISPR labeling of chromosomal...
  17. Neurodegeneration Research Collection

    Type
    Collection
    ...nerve cell function within the cell. Parkinson's Disease Parkinson’s disease (PD) is a chronic and progressive...neurodegenerative diseases include Alzheimer’s, Parkinson’s, ALS, and Huntington’s Disease. These diseases...as early-onset, where symptoms appear between a person’s thirties and mid-sixties, or late-onset, where...where symptoms appear during or after a person's mid-sixties. The early-onset form accounts for less than...created with support from the BRAIN Initiative. Jackson Laboratory (Link opens in a new window) A collection...A foundation dedicated to finding a cure for Parkinson's disease through an aggressively funded research... of improved therapies for those living with Parkinson's today. The Michael J. Fox Foundation has made...
  18. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...James M. Wilson 112864 pAAV2/8 AAV8 AAV packaging plasmid, expressing Rep2 and Cap8 James M. Wilson 112865...not known to cause disease in humans. For these reasons, AAVs are generally contained at lower biosafety..., expressing adenovirus E4, E2A and VA James M. Wilson RepCap Plasmids for Serotypes Available as a Viral...packaging plasmid, expressing Rep2 and Cap1 James M. Wilson 104963 pAAV2/2 AAV2 AAV packaging plasmid, expressing...packaging plasmid, expressing Rep2 and Cap9 James M. Wilson 112866 pAAV2/rh10 AAVrh10 AAV packaging plasmid...plasmid, expressing Rep2, and rh10 capsid James M. Wilson 81070 rAAV2-retro helper AAV retrograde AAV packaging...
  19. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ...website. For a comprehensive comparison to GFP, please refer to NEB's comparison of SNAP-tag, CLIP-tag, and...1998) References George N, Pick H, Vogel H, Johnsson N, Johnsson K. 2004. Specific labeling of cell surface...9712910 Vivero-Pol L, George N, Krumm H, Johnsson K, Johnsson N. 2005. Multicolor imaging of cell surface...
  20. Retrograde AAV viral preps

    Type
    Collection
    ...Recombinases Wilson 105553 pENN.AAV.hSyn.Cre.WPRE.hGH Syn Cre expression Recombinases Wilson 105558 pENN.AAV.CamKII...105547 pENN.AAV.EF1a.eGFP.WPRE.rBG EF1a EGFP Control Wilson 24593 AAV-pgk-Cre PGK Cre expression Recombinases...pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn EGFP-tagged Cre expression Recombinases Wilson 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII...0.4.Cre.SV40 CamKII Cre expression Recombinases Wilson 107738 pAAV-hSyn-Cre-P2A-dTomato Syn Cre expression...AAV.rTH.PI.Cre.SV40 rTH Cre expression Recombinases Wilson 55634 pAAV-EF1a-mCherry-IRES-Flpo EF1a Flpo and...
Showing: 1 - 20 of 68 results