Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 255 results for: tre promoter

Showing: 101 - 150 of 255 results

  1. Pathways Over Time Plasmids Engage Students in Functional Genomics Research

    Type
    Blog Post
    ... the pYES2.1 plasmid is controlled by the GAL1 promoter. The cloning procedure adds both V5 and His6 epitope...grow in the absence of methionine. Since the GAL1 promoter controls MET/Met gene expression, complementation...Associate Professor at Boston College. National reports stress the importance of providing authentic research ...

  2. PITChing MMEJ as an Alternative Route for Gene Editing

    Type
    Blog Post
    ...Addgene are perfect for expressing GFP from a given promoter, and the technique can be adapted to other transgenes...observed will be dependent on both the endogenous promoter and the 3’ UTR of the locus of interest, since...of a GFP-Puro cassette into a given locus, just upstream of a stop codon. Briefly, the PITCh vector should...since the GFP-Puro will be inserted just upstream of a stop codon. One potential concern is if the GFP-Puro...

  3. INTEGRATE: Bacterial Genome Engineering Using CRISPR-Transposons

    Type
    Blog Post
    ... VchINT, three separate plasmids and multiple promoters were used to express the necessary components ...required genes and the CRISPR RNA under the same promoter, and a donor plasmid (pDonor) encodes the mini-transposon...labs (Peters et al., 2017; Klompe et al., 2019; Strecker et al., 2019), which direct RNA-guided transposition...Halpin-Healy et al., 2020). Genomic targets require an upstream 2-bp PAM sequence for recognition by QCascade;...from the donor molecule, and inserts it ~50 bp downstream of the genomic target site bound by QCascade ...structures known as cointegrates (Vo et al., 2020; Strecker et al., 2020).  CRISPR-transposons for bacterial...et al., 2019). Recently, the lab introduced a streamlined expression approach (Fig. 2A), involving two-...

  4. Deciphering the Mysteries of Behavior with Viral Vectors

    Type
    Blog Post
    ... and triggering release of the stress hormone norepinephrine to promote vigilance. A recent study investigated... "Dorsal raphe neuroinflammation promotes dramatic behavioral stress dysregulation." Journal of Neuroscience...readout for associated emotional phenomena like stress levels, but researchers have to be mindful of motivation...coeruleus (LC) is known to play a major role in the stress response circuit by integrating neuronal signalling...freezing response, a form of immobility caused by stress and fear. Such a behavior can be monitored in an... 1970s to test the efficacy of antidepressant treatment in rodents. In this test, an animal is placed ... cortical noradrenergic excitability upon acute stress." The EMBO journal 37.21 (2018). PubMed PMID: 30209240...

  5. Addgene’s Top 10 Blog Posts from 2014

    Type
    Blog Post
    ...Competent Cells By Melina Fan Plasmids 101: The Promoter Region – Let's Go! By Kendall Morgan Plasmids...the experts in the CRISPR/Cas field, have been extremely helpful for scientists that are looking for more...on “Making Your Own Competent Cells” has been extremely popular, generating many additional questions....

  6. A New Generation of Adenine Base Editors Improves Editing in Primary Human Cells

    Type
    Blog Post
    ...studies have shown that one base change in the promoter region of gamma hemoglobin (HGB1/2) leads to continuous.... ABE8 efficiently edited the fetal hemoglobin promoter and caused persistent expression of fetal hemoglobin... domain can edit the short single-stranded DNA stretch that is accessible. Image from Gaudelli et al.,...

  8. Chromoproteins: Colorful Proteins For Molecular Biology Experiments

    Type
    Blog Post
    ... toxin gene (regulated by a rhamnose-inducible promoter) and a chromoprotein gene. Allelic exchange occurs...it is under the control of a rhamnose-inducible promoter. The resolution step leads to the desired mutation... the loss of their symbiotic algae, during heat stress. For other organisms, like the sea anemone, scientists...

  9. Lentiviral Vector Uses and Overview

    Type
    Blog Post
    ...a chimeric 5’ LTR containing a Tat-independent promoter. Although safer, this system may be more cumbersome... vectors integrate into the genome, they could promote oncogenesis by altering local gene expression. ...HIV-1 envelope. As of 2013, 65 patients had been treated with this therapy, which lowered viral load and...15(2):78-82. PubMed PMID: 23322669. 6. Genetic treatment of a molecular disorder: gene therapy approaches...

  10. Tips for Screening with Yeast Two Hybrid Systems

    Type
    Blog Post
    ...that also contains a reporter gene cloned downstream of a promoter containing the target sequence of the ...as the “prey”) in close enough proximity to the promoter of the reporter gene to activate expression (Figure...fusion protein shown is still able to bind to the upstream activation sequence (UAS) of its target gene, ...

  11. Bacterial Toxin-antitoxin Systems as Molecular Biology Tools

    Type
    Blog Post
    .... MazF expression is under control of the AOX1 promoter whose expression is induced by methanol. Once ...luciferase-expressing plasmids to examine in vivo-induced promoters in the Vibrio cholerae vaccine strain CVD 103-...However, the sok antisense-RNA binds a sequence downstream of the mok SD resulting in a double stranded ...

  12. Synthetic Biology, Artificial Chromosomes, iGEM & More - Interview with Tom Ellis

    Type
    Blog Post
    ...screening direct interactions between drugs and promoters of oncogenes. He returned to academic research...Podcast features guest host and Addgene European Outreach Scientist, Benoit Giquel. Traveling from our offices...in Academia. Will it all pay off? Chapter 2: The Centre for Synthetic Biology and Innovation - A shared...Tom Ellis! Dr. Ellis is a lead researcher at the Centre for Synthetic Biology and Innovation, Imperial ...project. His team also investigates bacteria and extremophiles for biotechnology and has been directly involved...

  13. The Fluorescent Vegetables in Aptamer Soup

    Type
    Blog Post
    ...transcription by placing the aptamer downstream of a known promoter. Addgene’s Plasmids 101: Aptamer Fluorophores... RNA Polymerase III. By expressing Corn under promoters for transcripts uniquely transcribed by RNA Polymerase...for imaging in live cells. By placing Spinach downstream of a riboswitch, metabolite binding to the riboswitch...ability to track RNA dynamics in a model of Fragile-X tremor/ataxia syndrome (Strack et al., 2013). Since then...

  14. CRISPR Activation: A Practical Guide

    Type
    Blog Post
    ...Cas9 would have an off-target that lands in the promoter of another gene, thereby driving aberrant transcription... said, we generally pick guides by putting the promoter of the gene into a gRNA finder such as WU-CRISPR...targeting the guides to a region less than 200 bp upstream of TSS for best results but up to 400 bp works...10.1016/j.cell.2014.09.029 Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib...

  15. Adeno-associated Viruses (AAVs) for Genome Editing

    Type
    Blog Post
    ...the targeting vector is inserted downstream of a functional promoter (gene traps). The resultant gene ...pAAV-TK-Acceptor has a conventional heterologous promoter-driven TK-neoR gene. To modify these tagging vectors...pAAV-SEPT-Acceptor, the preferred vector, contains a promoterless splice acceptor-IRES-neoR gene, which enhances...AAV preps generally used for gene editing are low titre, and are therefore able to infect only a small subset...

  16. Bacterial Expression Systems

    Type
    Collection
    ...coli strain. Addgene Blog Inducible Promoters Repressible Promoters Synthetic Photobiology: Optogenetics...pRU1701 Promoter activity Fluorescence (GFP+) Gram-negative bacteria Philip Poole 14460 pOT2 Promoter activity...pCHERRY3 Promoter activity Fluorescence (mCherry) Mycobacterium sp. Tanya Parish 24657 pASTA3 Promoter activity...#1000000037) contains specific bacterial promoters that vary in strength and that can be used to reliably drive...periplasmic localization: PelB, MalE, OmpA ID Plasmid Promoter Tags PI Additional Addgene Protein Purification...Toolkit (Addgene #1000000080) features a library of promoters and purification tags compatible with Golden Gate...temperature, in different bacterial systems. ID Plasmid Promoter Inducer Expression Species PI 44249 pdCas9-bacteria...

  17. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...sequence into a backbone that uses the human U6 promoter to drive expression, is it necessary to add a ... start of my target sequence? A3: The human U6 promoter prefers a 'G' at the transcription start site ...of the crRNA) is also expressed from a separate promoter. In the pre-processing form, the crRNA contains...they also be targeted? A4: The Cas9 cuts 3–4 bp upstream of the PAM sequence. There can be some off-target...suggestions? A14: The Zhang lab recommends using the Epicentre QuickExtract solution to perform this step to ...D., Lin, C., Gootenberg, J. S., Konermann, S., Trevino, A. E., Scott, D. A., Inoue, A., Matoba, S., Zhang...

  18. Plasmids 101: Common Lab E. coli Strains

    Type
    Blog Post
    ...your plasmid – you carefully selected the optimal promoter for your gene of interest, painstakingly cloned...Plasmids 101 Posts: Origin of Replication The Promoter Region – Let's Go! Mammalian Vectors Looking ..., and may have even put a fluorescent protein downstream, separated by an IRES element. You did a lot ...subunit S12 of 30S ribosome Confers resistance to streptomycin Tn10   Confers resistance to tetracycline ...galK rpsL (StrR) endA1 nupG fhuA::IS2 DB3.1 Streptomycin  HB101 derivative. For propagating plasmids ...lacY1 proA2 rpsL20(Smr) xyl5 Δleu mtl1 DH10B Streptomycin MC1061 derivative. General cloning and storage...galU galK λ- rpsL (StrR) nupG trfA dhfr HB101 Streptomycin Hybrid of E. coli K12 and E. coli B (mostly ...

  19. Twenty Years of Sharing: Expanding Accessibility

    Type
    Blog Post
    ... pages, we added curation fields for purpose, promoters, expression types, and more, all of which help...How to Design Your gRNA for CRISPR Editing The Promoter Region - Let's Go! How to Verify Your Plasmid ... easier access to export-controlled items by streamlining permissions and paperwork. Through updating ...

  20. Plasmids 101: Broad Host Range Plasmids

    Type
    Blog Post
    ...resistance cassettes (Prior et al. 2010), inducible promoters with different degrees of stringency and inducibility...Development of constitutive and IPTG-inducible integron promoter-based expression systems for Escherichia coli ...spheroides, Salmonella spp., Serratia marcescens, Streptomyces lividans, Synechococcus spp., Thiobacillus ferrooxidans...

  21. CRISPR-based Genome Editing Systems For Editing in E. coli

    Type
    Blog Post
    ...following changes. In pCas9, we 1) replaced the promoter of gRNA-pMB1 with PrhaB, 2) changed the replicon...pCutamp cures the plasmids by targeting the ampR promoter in all three plasmids. pCutamp is then removed... B strains, 1 E. coli W strain, and 1 Tatumella citrea, with a total of 70 sites edited. We optimized ...

  23. What's New in CRISPR - December 2019

    Type
    Blog Post
    ...this system is tunable via a rhamnose-inducible promoter. While this system was optimized for Burkholderia...deaminase (TadA) to a catalytically impaired Streptococcus pyogenes Cas9. They called this editor Target-ACE...

  24. Four Ways to Package Transgenes That Exceed the Size Limit of Adeno-associated Virus

    Type
    Blog Post
    ...AAV encoding part A of the transgene contains a promoter and the 5’-fragment of the transgene, followed... encoding part A of the transgene contains the promoter, the 5’ half of the transgene, a splice donor ...degron, or degradation sequence, upstream of the 5’ splice donor and downstream of the 3’ splice acceptor of...of wild-type dystrophin in normal muscles, mice treated with the overlapping split vector had an improvement...codon from donor A in any of the reading frames downstream of the gRNA target site so that transcripts undergo...

  25. Plant Plasmids and Resources

    Type
    Collection
    ...containing promoters that drive general and species-specific gene expression (see the column ‘promoter’ in the...for, such as the promoter or cloning method of choice. ID Plasmid Description Promoter Cloning Method PI...Synthetic Biology Research Centre (Link opens in a new window) - The initiative promotes interdisciplinary exchange... nucleases, base editors, gRNA backbones, and promoters for expression in monocots and dicots - Vladimir... for features you are looking for, such as the promoter or fluorescent protein of choice. Visit our Fluorescent...Proteins Guide for more. ID Plasmid Description Promoter PI Return to top Other Resources Addgene Blog ...modules for assembly of CRISPR/Cas9 constructs - Sylvestre Marillonnet and Johannes Stuttmann. Combined fluorescent...

  26. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Browse CRISPR...for directed evolution. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas...-directed repair (HDR). ID Plasmid Gene/Insert Promoter Selectable Marker Publication Prime Edit Cas9 ...edits on an RT template. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Interfere Catalytically...Design your gRNA to target your gene of interest’s promoter/enhancer or the beginning of the coding sequence...

  27. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function... on the opposite strand) mutations. ID Plasmid Promoter PI Publication Nick CRISPR/Cas nickase mutants...-directed repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused...edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter PI Publication Interfere Catalytically dead dCas9...Design your gRNA to target your gene of interest’s promoter/enhancer or the beginning of the coding sequence...

  28. Science as Art

    Type
    Blog Post
    ...emotional response within the viewer, which could promote conservation efforts, as the subject matter is ...display.   Many universities are now following the trend and encouraging departments to showcase the work...

  29. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...Chien lab (Kwan et al., 2007) and includes four promoters, six fluorophores with nonoverlapping emission...neurodegenerative diseases, the Cole Lab selected promoters for cell types directly linked to disease, including... components can be controlled by a variety of promoters for versatile and robust engineering. These components...monocytogenes  pCSW21  Yes  pJH376 Yes   acrIIA3 Streptococcus pyogenes  pCSW24  N/A (Toxic) pJH375  No  ...

  30. Arabidopsis in Education: How the Arabidopsis Biological Resource Center Brings Plant Science to Life

    Type
    Blog Post
    ...she focuses in public engagement in science and promoting plant science in K-12 education.     Additional...support. Growing capacity - ABRC outreach today Over the years, the outreach efforts of ABRC have grown. A... guest blogger Courtney Price, the Education & Outreach Specialist for the Arabidopsis Biological Resource...out to remedy that with the establishment of an outreach program in 2011. More than a model System - Arabidopsis...support from the National Science Foundation, ABRC’s outreach program kicked off with the release of 20 education...materials are available free-of-charge from the ABRC Outreach website. Seeds, which are free for K-12 teachers...staff reached more than 4,000 people through our outreach efforts. Our education partnerships have grown...

  31. Caltech Systemic Capsids

    Type
    Collection
    ... window) . Browse Available PHP.eB AAV ID Name Promoter Description Category PI Controls 28306 pAAV-FLEX-tdTomato... #103006) . Browse Available PHP.S AAV ID Name Promoter Description Category PI 28306 pAAV-FLEX-tdTomato...#127847) . Browse Available PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP...#185136) . Browse Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#185137) . Browse Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175004) . Browse Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175005) . Browse Available CAP-B22 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...

  32. Tag Your Favorite Yeast Genes with Ease

    Type
    Blog Post
    ... and partial gene deletion, overexpression (by promoter substitution), and tagging at either the N- or...site (TEV or PreScission), epitope tag (12xHis, 2xStrep, 3xFlag, Protein A, or V5), and selection marker...

  34. Supporting Rare Disease Research with BeHeard 2017

    Type
    Blog Post
    ...connecting patients to important resources and promoting research for rare disease cures. Through their...mesothelioma, there are currently no targeted treatments for peritoneal mesothelioma. Dr. Nabavi and colleagues...

  35. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...specific times or locations using cell-specific promoters or inducible systems, you can precisely control...fragments and placed under the control of different promoters. Expression of both fragments in the same cell... lox-STOP-lox shRNA constructs, Cre expression promotes shRNA expression. Gene Switch: These constructs...plasmids based on your expression system of choice, promoter, or search by inducible system (e.g., search for...Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Explore our full...Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Search our full...

  36. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...interest to create a luciferase reporter Promoter Measure promoter strength pBV-Luc - Luciferase ...plasmid with a promoter that will be functional in your host organism. Host Relevant Promoters Representative...sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for Agrobacterium-mediated ...proteins, a multiple cloning site (MCS), an inducible promoter, and/or a selectable marker. They are frequently...T-DNA entry plasmid (attR1 & attR2); Zea mays Ubi1 promoter and Hygromiycin resistance marker Also see more... expression under the metallothionein promoter pFastBac LIC and pFastBac Dual LIC - Vectors from...Gileadi lab Worm unc-54, variety of worm gene promoters C. elegans vector kit - Collection...

  37. Antibodies 101: Fc Effector Functions

    Type
    Blog Post
    ...10.1016/j.it.2007.11.004 Xu Cao, et al. Promoting antibody-dependent cellular phagocytosis for effective...There are a lot of different receptors, but their downstream effects can be sorted into three main effector...functions may be useful for inducing immunity or treating diseases (Cao, et al, 2022). So the next time ...region contributes to affinity and specificity. Trends in Immunology, 29(2), 91–97. https://doi.org/10.1016...

  38. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...Insert Promoter Selectable Marker PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter Selectable...CRISPR Guide . Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top...Publication Return to top Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top...top Zebrafish ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top CRISPR Resources...engineered to convert adenosine to inosine, which is treated like guanosine by the cell, creating an A to G ...

  40. mTOR Pathway

    Type
    Collection
    ...signals. mTORC2, which appears to signal upstream of Akt, also promotes cell survival and proliferation. mTOR...anabolic to catabolic processes. Active mTORC1 promotes protein and lipid synthesis, and increases energy... cancer. Loss of the tumor suppressor p53 also promotes aberrant mTORC1 activity, and multiple familial...mTORC1. The hyperactivation of mTORC1 in cancer promotes the conditions needed for uncontrolled cell growth...responds to various signals, including amino acids, stress, oxygen, energy levels, and growth factors. mTORC1...ovarian, and liver cancers. mTORC1 is activated downstream of PI3K/Akt and MAPK/ERK, both of which are commonly...

  41. Hot Plasmids and Viral Preps - September 2021

    Type
    Blog Post
    ...optimized their initial system by using a stronger promoter and different biochemical secondary energy sources...’s lab previously developed such a system in Streptomyces, a prokaryotic genus capable of producing a ...transient reporter for editing enrichment”, or XMAS-TREE, to identify base edited cell populations without...TGG.”  After identification of ABE activity, XMAS-TREE can also be used to purify these modifications and...with them further. The lab demonstrated that XMAS-TREE can be multiplexed and can be used in human pluripotent...Figure 1: Identification and enrichment use of XMAS-TREE. a) Cells are transfected with three different vectors...Quantification of base-editing efficiency using XMAS-TREE-based methods at various genomic loci in four different...

  42. Addgene's a Nonprofit? Nonprofit Awareness Day 2017

    Type
    Blog Post
    ... awareness day, we layout the ways in which we promote our mission and work to enable researchers around...collaboration, and fun Addgene believes there is strength in diversity and in empowering team members to...

  43. Celebrate Open Data Day with Addgene’s AAV Data Hub!

    Type
    Blog Post
    ...the database by certain features like serotype, promoter, or tool type and each entry contains an image...Immunohistochemistry? Did you use any relevant animal treatment conditions like drugs (Chemogenetics) or light...

  44. Validated gRNA Sequences

    Type
    Collection
    ...CYC1m promoter S. cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S.... or repression experiments use targets within promoters. When possible, the categories described on Addgene's... 46917 interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes...pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949...23977949 Lu CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m...GTTGAAAGTATTAGTTAAAG 64388 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate...

  45. Plasmids 101: Origin of Replication

    Type
    Blog Post
    ...express massive amounts of protein given the proper promoter and growth conditions. Choose your origin of...bonds not three as G-C pairs are. As a result, stretches of DNA that are rich in A-T pairs can be separated...against you!  The culture inoculum Freshly streaked bacteria have higher copy numbers – for optimal...also give a higher plasmid yield that colonies streaked from a glycerol stock. Incubation for 12-16 hours...

  46. Advice for Moving Into Sales After Your Science Postdoc

    Type
    Blog Post
    ...alongside the customer. From there a move with either promotions or further education may allow you to transition... and reading some of these articles would have stressed me out more than necessary for my interview. The...mechanisms of cell division. Recently Seán got the entrepreneurial bug and has set up an ELISA kit company on ...

  47. Revamp Your Lab Meetings With Creative Virtual Collaboration

    Type
    Blog Post
    ... Zoom meetings, different tools can be used to promote creative interaction. A great tool that a few people...of work styles while work remotely. The authors stress the fact that “miscommunication, a lack of leadership...of the book “The Salmon Leap for PhDs: Swimming upstream a career from academia to industry”. To date, ...

  48. Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein

    Type
    Blog Post
    ...will be suitable). For N-terminus tagging, the promoter region of both the alleles should be sequence-...cautiously analyzed for any damage (indels) to the promoter region of the non-HDR allele. For N-terminal tagging...cuts 8-15 bp downstream of Stop codon; for N-terminus tagging, a crRNA cutting 8-15 bp upstream of your gene...Dewari, a postdoc in Steve Pollard’s lab at the MRC Centre for Regenerative Medicine (CRM), Edinburgh. Most...universal all-purpose “tag antibody” can be used for downstream IP/ChIP assays. Creating epitope-tagged clonal... is a postdoc in Steve Pollard’s lab at the MRC Centre for Regenerative Medicine (CRM), Edinburgh. His...

  49. How to Deposit Your Plasmids with Addgene

    Type
    Blog Post
    ...You will have the option to indicate separate promoters, tags, or cloning information for each insert.... 8: Add vector backbone information. List any promoters, cloning details for how your gene was inserted...possible Entrez Gene matches to your insert. Select the appropriate gene if it appears in the Entrez Gene ...associated with your insert. Pro Tip! If the correct Entrez Gene does not appear in the auto-populated list...at a concentration of 0.1–1 µg/µL (or bacterial streaks, if you prefer). If you wish to edit your plasmid...

  50. Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins

    Type
    Blog Post
    ...microscope and GFP fusion proteins controlled by promoters specific to the immune lineage, scientists could...Finsterbusch, Michaela, et al. "Patrolling monocytes promote intravascular neutrophil activation and glomerular...that T cells were able to extravasate from the bloodstream to invade lymph nodes and scan antigen presenting...
Showing: 101 - 150 of 255 results