We narrowed to 115 results for: Atr

1. Validated gRNA Sequences

   Type

   Collection

   ...26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron leu2 S. ... 26616834 Patron PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron Prnp M. musculus...

2. A new platform for fast functional characterization of potentially cancerous mutations

   Type

   Blog Post

   .... The possibilities are vast. References Ng, Patrick Kwok-Shing, et al. "Systematic functional annotation...

3. CRISPR Protocol for Genomic Deletions in Mammalian Cell Lines [Video]

   Type

   Blog Post

   ... you to our guest bloggers! Daniel Bauer is a pediatric hematologist and principal investigator at Boston...

4. "What Makes a Good Mentor?" and 6 More FAQs About Science Mentoring

   Type

   Blog Post

   ...Mentor Do I Want To Be?” In this excellent essay Acclimatrix, an assistant professor at a research university...

5. Tag Your Favorite Yeast Genes with Ease

   Type

   Blog Post

   ...JR. Yeast. 1998 Jul;14(10):953-61. Note: Marcy Patrick contributed to the writing of this article....

6. pSiM24: Simplifying Plant Genetic Engineering

   Type

   Blog Post

   ...Transgenesis with GreenGate Plasmids Interview: Nicola Patron on Plant Synthetic Biology, MoClo, and More Plasmids...

7. Immunology Research Plasmids and Resources

   Type

   Collection

   ...FMRFAL NPPA natriuretic peptide precursor A ANF, ANP, ATFB6, CDD-ANF, PND NPPB natriuretic peptide precursor...precursor B BNP NPPC natriuretic peptide precursor C CNP NPR1 natriuretic peptide receptor A/guanylate ...cyclase A (atrionatriuretic peptide receptor A) ANPRA, ANPa, GUC2A, GUCY2A, NPRA NPR3 natriuretic peptide...type 2 AT2, ATGR2, MRX88 AMBN ameloblastin (enamel matrix protein) - AMELX amelogenin (amelogenesis imperfecta...peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) ANPRC, GUCY2B, NPRC NPY neuropeptide...

8. ReFigure: Save Scientific Figures into Dashboards and Share Your Insights

   Type

   Blog Post

   ...replications as in this ReFigure about whether Natronobacterium gregoryi Argonaute has any DNA editing functionality...

9. Plasmids 101: What is a plasmid?

   Type

   Blog Post

   ...please let us know in the comments. Note:Marcy Patrick contributed to the writing of this article. ...

10. FastCloning: A Newer, Simpler Cloning Technique

    Type

    Blog Post

    ... in protein science.     References: 1. Celie, Patrick HN, Annabel HA Parret, and Anastassis Perrakis....

11. Plasmids 101: Antibiotic Resistance Genes

    Type

    Blog Post

    ... Marcy Patrick...

12. Lentivirus Plasmids

    Type

    Collection

    ...shRNA. See Szulc et al. (2006) for more variants. Patrick Aebischer and Didier Trono 11795 pLL3.7 3rd Expresses...expressing envelope plasmid. Arthur Nienhuis and Patrick Salmon 17532 pLTR-G Expression of VSV-G glycoprotein...VSV-G-expressing envelope plasmid. Arthur Nienhuis and Patrick Salmon 22501 pHEF-VSVG VSV-G-expressing envelope...

13. Hot Plasmids June 2018 - Reverse transcriptase, nanobody, and protein-DNA interaction tools

    Type

    Blog Post

    ... the cell surface Article contributed by Marcy Patrick  Listen to the nanobody toolkit podcast segment...

14. Plasmids 101: Origin of Replication

    Type

    Blog Post

    ... do you choose? Addgene Senior Scientist Marcy Patrick says researchers can ask themselves a few questions...

15. Plasmids 101: A Brief History of Plasmids and an Improved eBook!

    Type

    Blog Post

    ... Marcy Patrick...

16. Donations from Addgene to Yield Answers for Rare Disease Researchers

    Type

    Blog Post

    ...with one form of Waardenburg syndrome (WS4) by Pediatrician Duangrurdee Wattanasirichaigoon carried different...

17. Rett Syndrome

    Type

    Collection

    ...in Australia: a review of the epidemiology. J Pediatric . 148(3):347-352. (Link opens in a new window)...Methyl-CpG binding protein 2. Am J Med Genet B Neuropsychiatr Genet . 180, 55–67. PMID: 30536762 Shahbazian...diagnosticians and risk factors for late diagnosis. Pediatr Neurol . 52, 585-591.e2. PMID: 25801175 Tillotson...

18. Celebrate National Book Month with Addgene

    Type

    Blog Post

    ..., there is always another secret."     - Marcy Patrick, Associate Director of Quality Control Jonathan...

19. Predicting Adverse Reactions to Monoclonal Antibody Drugs

    Type

    Blog Post

    ...one of the more common open-access tools, while EpiMatrix is a commercially available algorithm to evaluate...

20. R Bodies: Membrane-Rupturing Microscopic Tools

    Type

    Blog Post

    ...other barriers (like vasculature or extracellular matrices) in response to pH changes. Beyond these applications...