We narrowed to 16 results for: Atr
-
TypeCollection...activating factor 1 ATM ATM serine/threonine kinase ATR ATR serine/threonine kinase B99 G-2 and S-phase expressed...ribonucleotide reductase M2 B (RRM2B) PAG608 Zinc finger, matrin-type 3 PAI Serpin peptidase inhibitor, clade E ...
-
Neurodegeneration Plasmid Collection
TypeCollection...Arrowsmith 32880 FLAG-MATR3 MATR3 Flag CMV ALS Yossi Shiloh 32881 FLAG-Matr3 delRRM1 MATR3 Flag CMV ALS Yossi...Shiloh 32882 FLAG-Matr3 delRRM2 MATR3 Flag CMV ALS Yossi Shiloh 32883 FLAG-Matr3 delZnF1 MATR3 Flag CMV ALS...174271 pAPM-miR30-MATR3-ts1 MATR3 SFFV ALS Jeremy Luban 174272 pAPM-miR30-MATR3-ts2 MATR3 SFFV ALS Jeremy...H1 ALS Patrick Aebischer 10881 pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1mismatch SOD1 H1 ALS Patrick Aebischer...ALS Yossi Shiloh 32884 FLAG-Matr3 delZnF2 MATR3 Flag CMV ALS Yossi Shiloh 34927 pTRE_tau-LacZ::tTA-H100Y...CMV Parkinson's Patrick Aebischer 36070 pAAV asyn S87A/S129A SNCA CMV Parkinson's Patrick Aebischer 36071...EGFP OPTN GFP CMV ALS Beatrice Yue 68839 pOPTN1-209-EGFP OPTN GFP CMV ALS Beatrice Yue 68840 pOPTN1-424... -
Validated gRNA Sequences
TypeCollection...26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron leu2 S. ... 26616834 Patron PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron Prnp M. musculus... -
Immunology Research Plasmids and Resources
TypeCollection...FMRFAL NPPA natriuretic peptide precursor A ANF, ANP, ATFB6, CDD-ANF, PND NPPB natriuretic peptide precursor...precursor B BNP NPPC natriuretic peptide precursor C CNP NPR1 natriuretic peptide receptor A/guanylate ...cyclase A (atrionatriuretic peptide receptor A) ANPRA, ANPa, GUC2A, GUCY2A, NPRA NPR3 natriuretic peptide...type 2 AT2, ATGR2, MRX88 AMBN ameloblastin (enamel matrix protein) - AMELX amelogenin (amelogenesis imperfecta...peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) ANPRC, GUCY2B, NPRC NPY neuropeptide... -
Rett Syndrome
TypeCollection...in Australia: a review of the epidemiology. J Pediatric . 148(3):347-352. (Link opens in a new window)...Methyl-CpG binding protein 2. Am J Med Genet B Neuropsychiatr Genet . 180, 55–67. PMID: 30536762 Shahbazian...diagnosticians and risk factors for late diagnosis. Pediatr Neurol . 52, 585-591.e2. PMID: 25801175 Tillotson... -
Deisseroth INTRSECT Collection
TypeCollection...S, Sienna AC, Tepler S, Poulin JF, Ansorge M, Awatramani R, Kang UJ, Rayport S. 2018. Dopamine neuron ...Ramakrishnan C, Chan CS, Dombeck DA, Deisseroth K, Awatramani R. 2018. Mapping projections of molecularly defined...hypothalamus-habenula circuit controls aversion. Mol. Psychiatry 24(9):1351-1368. PubMed (Link opens in a new ... -
Fluorescent Protein Guide: Biosensors
TypeCollection...green- and orange-emitting proteins Ratiometric Matryoshka biosensors from a nested cassette of green- and...Recording of Zn(2+) Dynamics in the Mitochondrial Matrix and Intermembrane Space with the GZnP2 Sensor. ...Nat Methods. 2023 Sep;20(9):1426-1436. Tommaso Patriarchi Norepinephrine GRAB_NE family of GPCR activation-based... Nat Methods. 2022 Feb;19(2):231-241. Tommaso Patriarchi Serotonin Red and green serotonin sensors GRAB... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TCTTCTTGTGCTCTTATTggcaggtacctggtgacTCACCTTATGGGCGCTGA matrixmetallopeptidase15 (membrane-inserted) TAL3484 & TAL3485 ...TGATCTGTTCCTGGTAGCcgttcatgagctgggcCATGCCCTTGGACTGGAA matrixmetalloproteinase14a (membrane-inserted) TAL3486 & TAL3487... -
Biosensor AAV Preps
TypeCollection...Constitutive 9 Patriarchi 187180 pAAV_hSyn1_nLightR Syn nLightR none Constitutive 9 Patriarchi Oxytocin (OT... -
Antibody Guide
TypeCollection...tissue sections are assayed and the extracellular matrix remains intact. The signaling molecule may be a..., cells have most or all of their extracellular matrix removed. Again, the signaling molecule may be a... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...Structure 87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP Alpha-tubulin... -
Control AAV Preps
TypeCollection...pAAV-CBh-mKate2-IRES-MCS (WT-WT) CBh mKate2 Constitutive 2 Patrick 114469 pAAV-CaMKIIa-mCherry CaMKIIa mCherry Constitutive... -
Bacterial Expression Systems
TypeCollection...pCyPet-His pYPet-His CyPet (donor) YPet (acceptor) FRET Patrick Daugherty 18084 54856 pBad-mAmetrine1.1 tdTomato-pBAD... -
Tetracycline Inducible Expression
TypeCollection...Tet-Off and additional plasmids. tetR-KRAB TRE Patrick Aebischer , Didier Trono 41393 pCW57.1 Lentiviral... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...-alpha Tubulin Microtubules alpha-tubulin EGFP Patricia Wadsworth 27123 eTC GFP beta-actin full length... -
Trimmer Lab NeuroMab Collection
TypeCollection...IgG2a 149455 Anti-MMP9 matrix metalloproteinase-9 precursor [L51/82R] MMP9 matrix metalloproteinase-9 precursor...