Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 142 results for: GAL

Showing: 41 - 60 of 142 results

  1. Six Spooky Science Stories and Halloween at Addgene

    Type
    Blog Post
    ...point where the temperature and humidity favors fungal growth. The ants bites down and locks their jaws...its muscles atrophy. After the ant’s death, the fungal fruiting bodies being to sprout out of the ant’...

  2. Addgene is Expanding Our Viral Vector Service!

    Type
    Blog Post
    ...small subset of AAV plasmids will have technical or legal restrictions that make them ineligible for use in...submitted, the request will be reviewed by Addgene for legal approvals and technical compatibility with our production...

  4. We're Updating Our Hold for Publication Policy

    Type
    Blog Post
    ... time to complete necessary quality control and legal approvals so the plasmids are ready for distribution...cancel the deposit due to experimental problems, legal restrictions, or any other reason. But this way,...

  5. Science Careers: Unruly Interests Feed Many Paths

    Type
    Blog Post
    ... – a career in the sciences is more like an intergalactic network. Which planet will you visit? Where ...into your backpack, and step out there into the galaxy. TL;DR: Many roads need scientists open for adventure...

  7. Addgene’s Viral Service - Why Virus? Why Now?

    Type
    Blog Post
    ...Addgenie in the company. Our Finance, Business and Legal teams had to pave the way for this project with ...out what we can afford to do and when. Addgene’s Legal Team acquired permission from relevant plasmid depositors...

  10. Developing Lab Management Software for Biology

    Type
    Blog Post
    ...need to track the location, quality, growth, and legal status of thousands of plasmids a day, like we do... all of Addgene - within the office, within our legal department, and, of course, within the lab. In order...

  13. Tips for Screening with Yeast Two Hybrid Systems

    Type
    Blog Post
    ...Although the original Y2H systems utilized the yeast Gal4 activator, bacterial LexA DBD and the lacZ reporter...Martinez-Arias A., Shapira S.K., Chou J. Beta-galactosidase gene fusions for analyzing gene expression in...

  14. Five Popular Model Organisms

    Type
    Blog Post
    ...fruit fly is the array of genetic tools, such as the GAL4/UAS and LexA system, that allows scientists to easily...systems but can be quite difficult and time consuming. GAL4/UAS was first described in 1993 by Norbert Perrimon...

  15. Validated gRNA Sequences

    Type
    Collection
    ...26355004 Mendenhall GAL4 UAS GAACGACTAGTTAGGCGTGTA 46916 activate S. pyogenes 23849981 Qi GAL4 UAS GTTGGAGCACTGTCCTCCGAACGT...23849981 Qi GAL4UAS TGGGGACAGTACTCCGCTCGAGT 64158 activate S. pyogenes 25619936 Sato GAL4UAS TGGGTCTTCGGAGGACAGTACTC...crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1...TGGGTCTTCGGAGGACAGTACTC 64157 activate S. pyogenes 25619936 Sato GAL4UAS TGGTCCGTCTAGAAACTCGGTAC 64159 activate S. pyogenes...

  16. Immunology Research Plasmids and Resources

    Type
    Collection
    ...ODG1 GAL galanin prepropeptide GALN, GLNN, GMAP, MGC40167 GALP galanin-like peptide - GALR2 galanin receptor...receptor 2 GALNR2, MGC125983, MGC125984 GALR3 galanin receptor 3 - GAST gastrin GAS GCG glucagon GLP1, ...PA28 alpha) IFI5111, MGC8628, PA28A, PA28alpha, REGalpha PSME1 proteasome (prosome, macropain) activator...PA28 alpha) IFI5111, MGC8628, PA28A, PA28alpha, REGalpha PSME2 proteasome (prosome, macropain) activator...interferon gamma transducer 1) AF-1, IFGR2, IFNGT1 ITGAL integrin, alpha L (antigen CD11A (p180), lymphocyte...

  17. Worm Expression Resources

    Type
    Collection
    ...promoter. cGAL and Split cGAL plasmids - Paul Sternberg Lab. Plasmids for the temperature-robust GAL4-UAS system...

  18. AAV Packaged on Request

    Type
    Collection
    ...facilitation for the transfer plasmid, including legal approval and an implementation letter DNA amplification...applicable transfer plasmid. We will help you gain legal usage of the transfer plasmid from the providing...materials, using them in the lab, and even managing legal permissions and distribution. Troubleshooting If...

  19. TALEN Plasmids and Kits

    Type
    Collection
    ...-BB contains the GAL1 promoter, placing TALORs built into this vector under galactose-inducible expression...Bogdanove/Voytas) in order to generate TALORs (TAL Orthongal Repressors) that can be used to custom repress...
Showing: 41 - 60 of 142 results