Skip to main content

We narrowed to 9 results for: GAL

Showing: 1 - 9 of 9 results
  1. Molecular Biology Reference

    Type
    Guide
    ...England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC...Phi80lacZΔM15 Δ-lacX74 recA1 araΔ139 D(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG tonA::Ptrc ccdA DB3.1 Invitrogen...Φ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL (StrR) nupG trfA dhfr JM109 Addgene; Promega...(TetR) ∆(ara-leu) 7697 araD139 fhuA ∆lacX74 galK16 galE15 e14- Φ80dlacZ∆M15 recA1 relA1 endA1 nupG rpsL...Phi80lacZM15 Δ-lacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG Common Antibiotics for ...sr1-recA) mcrB mrr hsdS20 (rB- mB-) supE44 ara14 galK2 lacY1 proA2 rpsL20(StrR) xyl5 lambda- leu mtl1 DH5alpha...mcrB mrr hsdS20 (rB-, mB-) recA13 supE44 ara-14 galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ- leu mtl-1 Top10...
  2. Sequencing Primers

    Type
    Guide
    ...origin Reverse GAL1 AATATACCTCTATACTTTAACGTC S. cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG...GGTGGTAATGCCATGTAATATG S. cerevisiae GAL10 promoter Forward Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain...domain Forward Gal4-AD AATACCACTACAATGGAT 3' end of Gal4 activation domain Forward GFP-F GGTCCTTCTTGAGTTTGTAAC...
  3. Modular Cloning Guide

    Type
    Guide
    ... CRISPR editing, and more. Fungal Toolkit for Modular Cloning (FTK) Fungal Expression, CRISPR Arnold Driessen...Cultivarium POSSUM Toolkit Bacterial Expression, Fungal Expression Nili Ostrov , Charlie Gilbert , and ...selection markers for a variety of bacterial and fungal species for engineering non-model microbes. AspFlex...
  4. Promoters

    Type
    Guide
    ... actin 5c gene Gal4/UAS Specific Insect Requires UAS regulatory element and yeast Gal4 gene; often used...Constitutive Mammalian Strong promoter from human cytomegalovirus EF1a Constituitve Mammalian Strong promoter...
  5. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...gene options, including: Gibbon Ape Leukemia Virus (GALV) — T and B cell transduction Murine Leukemia Virus...10.1093/nar/gkt1399 PMID: 24464997 Maetzig, T., Galla, M., Baum, C., & Schambach, A. (2011). Gammaretroviral...using a novel, CoDOn-Optimized gene for chimeric GALV envelope. Viruses , 13 (8), 1471. https://doi.org...
  6. CRISPR Guide

    Type
    Guide
    ... Gainetdinov, I., Yoon, Y., Song, C., Cao, Y., Gallant, J., Xue, W., Rivera-Pérez, J. A., & Sontheimer... Manchado, E., Concepcion, C. P., Bonetti, C., Vidigal, J. A., Han, Y., Ogrodowski, P., Crippa, A., Rekhtman...
  7. Chemogenetics Guide

    Type
    Guide
    ...Bonaventura J, Zemla R, Gomez JL, Ramirez MH, Hu X, Galvan A, Basu J, Michaelides M, Sternson SM (2019). Ultrapotent...
  8. Lentiviral Vector Guide

    Type
    Guide
    ....2016.17 PMID: 27110581 Naldini, L., Blömer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma,...
  9. Optogenetics Guide

    Type
    Guide
    ...both the identification of novel ChRs from other algal species and the development of synthetic variants...
Showing: 1 - 9 of 9 results