Skip to main content
Addgene

We narrowed to 920 results for: IRE;

Showing: 41 - 60 of 920 results
  1. CRISPR Guide

    Type
    Collection
    ...combination of wild type alleles, NHEJ-repaired alleles, and the desired HDR-edited allele. Therefore, it is...presence of the desired edit experimentally and to isolate clones containing the desired edit (see: Validate...) and the desired edits on a RT template. The PBS base pairs to the 3’ flap, and the desired edit is incorporated...transcription-activator-like effector nucleases (TALENs) required scientists to design and generate a new nuclease...the Cas enzyme. Basic Mechanisms of CRISPR The requirements for a CRISPR knockout assay are simple. You’...continue to anneal to the target DNA in a 3′ to 5′ direction. The location of any potential mismatches matters...of the PAM sequence. The resulting DSB is then repaired by one of two general repair pathways: the efficient...
  2. Plan Your Experiment

    Type
    Collection
    ...BioRender.com. Select Your Desired Genetic Manipulation Different genetic manipulations require different CRISPR...percentage of DNA breaks will be repaired by NHEJ instead of incorporating your desired edit through HDR. Base ...methods and often require screening a larger pool of cells to find one with your desired edit. Lastly, you...base edits Can be paired with restriction enzymes for further customization Usually paired with a sequencing...must be experimentally verified Cut Nick Homology Directed Repair (HDR) Generate specific genomic edits, ...or Cas9 fusions with proteins that promote HDR Requires a repair template Lower editing efficiency compared...Activate Design and Clone Your gRNA Achieving your desired edit comes down to location, location, location...
  3. Plasmids for Stem Cell Research

    Type
    Collection
    ...and study of stem cells, from iPSC generation to directed differentiation....the body and have the capacity to give rise to an entire organism. iPSC technology removes the possible ...below. Once iPSCs have been created they can be directly differentiated into specific somatic stem cells...Plasmids below. Alternatively, it is also possible to directly differentiate one differentiated somatic cell ...endogenously-tagged gene variants or browse Addgene’s entire collection of Stem Cell Research Plasmids . For...lentiviral plasmids A drug-inducible system for direct reprogramming of human somatic cells to pluripotency...Highly Efficient Reprogramming to Pluripotency and Directed Differentiation of Human Cells with Synthetic ...
  4. Antibody Guide

    Type
    Collection
    ...antibodies? Will you be using a direct or indirect detection method? If indirect, do you already have secondary...signal amplification through the indirect detection method. In the direct detection method, the signaling...most common types of ELISAs are direct or sandwich ELISAs. For direct ELISAs, an antigen or protein of...antibody methods, it can be done using either an indirect or direct method. Since IF uses fluorophore color to...cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires single-antibody...complex. Due to their increased manufacturing requirements, monoclonal antibodies are typically more expensive... Polyclonal antibodies are typically collected directly from animals and contain antibodies targeting ...
  5. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...technique creates diverse populations of mutants for directed evolution. ID Plasmid Gene/Insert Promoter Selectable...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...
  6. Brain Armamentarium

    Type
    Collection
    ...Alias: CN4361) Expression of jGCaMP8s in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...Alias: CN4360) Expression of jGCaMP8s in striatal direct pathway medium spiny neurons (D1 MSNs) Jonathan...: CN4035) Expression of CoChR-EGFP in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...Alias: CN4033) Expression of CoChR-EGFP in striatal direct pathway medium spiny neurons (D1 MSNs) Jonathan...Alias: CN3987) Expression of jRGECO1a in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...AAV for Cre recombinase expression in striatal indirect pathway D2-MSNs Jonathan Ting Viviana Gradinaru... AAV for Cre recombinase expression in striatal direct pathway D1-MSNs Jonathan Ting Viviana Gradinaru...
  7. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions...
  8. Genetic Code Expansion

    Type
    Collection
    ... 105829 pIRE4-Azi Azi-tRNA synthetase (EAziRS) p-Azido-phenylalanine (Azi) Mammalian TAG Irene Coin 105830...biologists have expanded the genetic code by redirecting specific codons to encode amino acids beyond ...E.coli and can be mutated and screened through directed evolution to charge the tRNA with a different ...-like click amino acids, tRNA M15 Mammalian TAG Irene Coin 113644 pRF0G-Tyr tyrosyl-tRNA synthetase M....182653 pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA Y306A/Y384F (AF) pyrrolysine (Pyl) tRNA.... Expresses yeast TrpRS/tRNA pair instead. For directed evolution of the liberated EcTrpRS/tRNA pair to...
  9. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...contains a special Protospacer Adjacent Motif (PAM) directly after where the crRNA would bind. (5) After the...double-strand break (DSB) induced by Cas9 could be repaired through non-homologous end joining (NHEJ) , an...homology arms was supplied, the break could be repaired according to this template, allowing for precise...tags, or loxP/FRT sites, among others. Homology-directed repair (HDR) allows us to create a variety of ...occurred at a truly astonishing pace, with work directed towards increasing on-target editing rates and...cuts only one strand of DNA and can be used with paired gRNAs to lower off-target cleavage frequency. Truncated...rely on NHEJ or HDR: Base editors : Base editors directly convert bases without creating a double-strand...
  10. Validated gRNA Sequences

    Type
    Collection
    ...25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661 Fire dpy‐10 C....25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA 59928 cut S. pyogenes 25161212 Fire rde-1(H974...pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT 60212 cut S. pyogenes 25161212 Fire sv40 promoter...CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG 65630 cut ...GATAAATGAGCATAATGAAC 59929 cut S. pyogenes 25161212 Fire rgs4 D. rerio GGAGAAGGTGAAGGACACTG 42246 cut S. ...GTGAGACGTCAACAATATGG 59930 cut S. pyogenes 25161212 Fire Rosa26 M.musculus ACTCCAGTCTTTCTAGAAGA 64216 cut...GGAACTCGTGTCAAAACAAC 59932 cut S. pyogenes 25161212 Fire unc-119 C. elegans GAATTTTCTGAAATTAAAGA 46169 cut...
  11. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions...
  12. Quick Guide to All Things Lentivirus

    Type
    Blog Post
    ...be separated by an internal ribosome entry site (IRES) and expressed under the same promoter. Alternatively...cells - one containing the gene of interest (pTet-IRES-EGFP, pPRIME-Tet-GFP-FF3) and one with either tTA...response element (RRE), an internal promoter, and the desired gene (transfer vector plasmid), 2) the HIV-1 genome...in terms of RCL generation because this vector requires only three HIV-1 genes (gag, pol, and rev) for...that there is often  background activity and it requires continuous administration of Dox to repress transgene...One drawback of the Tet system is that it often requires the delivery of two distinct expression vectors...This supernatant can be stored at 4 °C or can be directly added to your target cells. However in that case...
  13. CRISPR Plasmids - Plants

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions...
  14. CRISPR Plasmids - Yeast

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Description Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions... FLAG-tagged Cas9. Design your gRNA sequence to direct dCas9 to a specific locus, avoiding known transcription...plasmids that do not co-express a Cas protein can be paired with a wide variety of Cas-containing plasmids....
  15. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Monitoring the action of redox-directed cancer therapeutics using a human peroxiredoxin-2-based probe. Nat Commun... with peroxiredoxin-based probes Real-time monitoring of basal H 2 O 2 levels with peroxiredoxin-based...cellular locations. PLoS One. 2012;7(11):e49371. Direct comparison of a genetically encoded sensor and ...11/520/eaah3738. Justin Blau cAMP (cyclic AMP) cAMPFIRE cAMP biosensors with improved sensitivity Sensitive... PLoS One. 2011;6(12):e28245. Uwe Sauer Citrate Direct or inverse fluorescent biosensor for citrate (Citron...mitochondrial or cytosolic High-Performance Intensiometric Direct- and Inverse-Response Genetically Encoded Biosensors...mammalian expression (Constitutive or Cre-dependent) Directed Evolution of a Selective and Sensitive Serotonin...
  16. Worm Expression Resources

    Type
    Collection
    ...Wormbuilder website. General Tools Fire Lab C. elegans Vector Kit - Andrew Fire Lab. A set of vectors for C....characterized which allow researchers to express desired constructs in precise cell types and/or developmental...plasmids that can be used in worms, search Addgene's entire collection. ID Plasmid Description Gene/Insert ...modified approach has also been developed by the Fire laboratory and described in Efficient Marker-Free...vectors. C. elegans optimized fluorophores - Andrew Fire Lab. Available with and without PATC, which diminishes...
  17. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...off-target alterations and require only a single gRNA. Cas3 must be paired with the Cascade ( C RISPR-...can continue for many kilobases in one or both directions from the target region, effectively turning Cas3... Cas5, Cas6, Cas7, Cas8, and Cas11. Cascade is directed to target DNA using a gRNA and recruits Cas3. ...other proteins bound to DNA, and the break can be repaired by the cell’s endogenous repair mechanisms. Cas3...
  18. Viral Vector Guides and Plasmids

    Type
    Collection
    ...cultures, these plasmids direct the production of viral vectors that contain the desired genetic cargo. In turn...their mild immunogencity. These viral vectors can direct long-term transgene expression, but generally don't..., such as different promoters or tags, can even direct delivery of the genetic cargo to specific cell ...prevent uncontrolled viral replication, and the required genes are divided in the multi-plasmid system....
  19. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression mT-sapphire 399 511 Monomer (A206K) mT-Sapphire-N1 - Mammalian Expression mT-Sapphire-C1 - Mammalian...Structure Plasmids T-sapphire 399 511 26 4.9 1.3 hr Prone to dimerization pFA6a-link-yETSapphire-CaUra3 - Yeast...Mammalian Expression mT-Sapphire-pBAD - Bacterial Expression mAmetrine 406 526 26 6 0.8 hr Monomer (A206K...
  20. Rett Syndrome

    Type
    Collection
    ..., is regression of previously acquired skills, notably loss of acquired purposeful hand movements and ...Envigo. The following cell lines are available directly from the labs in which they were created. Find...rsrt.org The following cell lines are available directly from the labs in which they were created. Find... a p.R168X or p.T158M MECP2 mutation, and the direction and degree of skewing of X-chromosome inactivation...
Showing: 41 - 60 of 920 results