We narrowed to 47 results for: YFP tag

...HA-F TACCCATACGACGTCCCAGA HA tag Forward HA-R TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC...GAGGAGCACGCTCATGCCCAC Histidine affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator Reverse...promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse BGH-R TAGAAGGCACAGTCGAGG Bovine... EGFP Reverse EXFP-R GTCTTGTAGTTGCCGTCGTC For distinguishing EGFP vs ECFP vs EYFP Reverse F1ori-F GTGGACTCTTGTTCCAAACTGG...

...Figure 1: Plasmid mix to label neuronal morphology (eYFP) and the synaptic protein PSD95 (PSD95-mcherry) ...expressing fluorescent cytoplasmic markers (e.g. eYFP) and synaptic proteins (e.g. postsynaptic PSD95-... Figure 2: Expression of a morphological marker (eYFP) and synaptic marker (PSD95-mcherry), under the ...Properties of FLP Recombinase Evolved by Cycling Mutagenesis.” Nature biotechnology 16(7): 657–62. PubMed ...

... the research community. Customers have taken advantage of the customizability, choosing the cargo, serotype...Yizhar New viral tool pAAV-Ef1a-fDIO hChR2(H134R)-EYFP AAVrg Optogenetics Karl Deisseroth New viral tool...

...Serotype Name Depositor 27056 AAVrg pAAV-Ef1a-DIO EYFP Karl Deisseroth 11447 AAV5 pAAV-Ef1a-fDIO mCherry...tools for light mediated neuronal control. The advantages of optogenetics lie in the spatiotemporal control...recombination of lox sites. This system takes advantage of the extensive supply of transgenic reporter...

...rAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA minBetaGlobin SYFP2 Control Ting 163509 CN1839-rAAV-hSyn1-SYFP2-10aa-H2B-WPRE3...Dlx mRuby2 Control Gradinaru 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 104061 CAG-NLS-GFP CAG NLS-GFP...EF1a mCherry Control Deisseroth 117382 hSyn1-eYFP Syn EYFP Control Gradinaru 135630 pAAV-S5E2-dTom-nlsdTom...-BGHpA hSyn1 H2B-SYFP2 Control Ting 191706 AiP13044 - pAAV-AiE0779m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias...: CN3044) minBG SYFP2 Control AIBS , Ting 191707 AiP12237 - pAAV-AiE0452h-minBG-SYFP2-WPRE3-BGHpA (Alias... - pAAV-AiE0743m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3038) minBG SYFP2 Control AIBS , Ting 191726 AiP12787... - pAAV-AiE0140h_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2787) minBG SYFP2 Control AIBS , Ting 191728 AiP12408...

...H134R)-eYFP.WPRE.hGH Optogenetics Karl Deisseroth AV-1-26968P 26968-AAV1 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics...pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics Karl Deisseroth AV-1-26971P 26971-AAV1 pAAV-CaMKIIa-eNpHR 3.0-EYFP Optogenetics...eNpHR 3.0-EYFP Optogenetics Karl Deisseroth AV-5-26968P 26968-AAV5 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics...pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics Karl Deisseroth AV-5-26972P 26972-AAV5 pAAV-hSyn-eNpHR 3.0-EYFP Optogenetics...floxed-eNpHR-EYFP-WPRE-pA Optogenetics Karl Deisseroth AV-9-26966P 26966-AAV9 pAAV-Ef1a-DIO eNpHR 3.0-EYFP Optogenetics...H134R)-eYFP.WPRE.hGH Optogenetics Karl Deisseroth AV-9-26968P 26968-AAV9 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics...pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics Karl Deisseroth AV-9-26971P 26971-AAV9 pAAV-CaMKIIa-eNpHR 3.0-EYFP Optogenetics...

.../9R] ZIP3 Mouse Mouse IgG2a 206600 Anti-S-tag [N56/9R] S-tag Bovine Mouse IgG2a 206601 Anti-TrpC4 [N77... Human Mouse IgG2a 114476 Anti-Synaptotagmin-3 [N278/19R] Synaptotagmin-3 Mouse Mouse IgG2a 114477 Anti-TRPML3... Human Mouse IgG2a 114482 Anti-Synaptotagmin-12 [N277/7R] Synaptotagmin-12 Mouse Mouse IgG2a 114483 Anti-GluA1...) Rat Mouse IgG2a 114558 Anti-Synaptotagmin-10 [N269/73R] Synaptotagmin-10 Mouse Mouse IgG2a 114559 Anti-Ataxin... Mouse Mouse IgG2a 177526 Anti-Synaptotagmin-7 [N275/14R] Synaptotagmin-7 Mouse Mouse IgG2a 177527 Anti-Lgi1... Human Mouse IgG2a 188216 Anti-Synaptotagmin-6 [N270/47R] Synaptotagmin-6 Mouse Mouse IgG2a 188217 Anti-CASK...Shank3 Rat Mouse IgG2a 188223 Anti-Synaptotagmin-9 [N276A/15R] Synaptotagmin-9 Mouse Mouse IgG2a 188224 Anti-TrpV1...