Skip to main content

We narrowed to 398 results for: aga

Showing: 41 - 60 of 398 results
  1. Deep Dive: qPCR

    Type
    Blog Post
    ... Yes Agarose gel or uMelt analysis Hairpin probes Low Yes, one Yes Yes Agarose gels ...another means, such as an agarose gel or uMelt analysis (Downey, 2014). Agarose gels  A quick way to validate...double-quencher design Yes, one Yes Yes Agarose gel or uMelt analysis dsDNA dye (Sybr)  High...structure included in the 5’ primer Yes Yes. Agarose gel  LUX fluorogenic primers Low Single...fluorescent molecule connected to a primer  No Yes Agarose gel Sunrise primers   Low Reporter and ...hairpin structure included in primer Yes Yes Agarose gel Table 1: Features of various qPCR chemistries...primer probe is by running your qPCR product on an agarose gel, then cutting out and sequencing the band for...
  2. Lab Automation at Addgene

    Type
    Blog Post
    ...amount of agar. There is a tube that goes from the needle to the flask with agar in it. The agar sits on...magnet so that the agar doesn’t solidify while it goes through this process. With enough agar and the right...transformation, DNA purification, and filling vials with agar. I’ll also provide you with some tips on how to ...re transferring samples from 96 wells plates onto agar q-trays where the samples must be spread much farther... The majority of Addgene plasmids are shipped as agar stabs in glass vials. Have you ever wondered who...
  3. DNA Purification Without a Kit

    Type
    Blog Post
    ...purifying (plasmid, genomic, or DNA fragments from agarose).    In this article, we will go through the basics...filters Starting material: bacterial cultures or agarose gel slices Product: plasmids or DNA fragments The... extraction with glass milk Starting material: agarose gel slices Product: DNA fragments You might be ...“How is milk going to help me extract DNA from agarose gel?!”   The DNA gel extraction with glass milk... this protocol: 1) it solubilizes both DNA and agarose, and 2) it helps DNA stick to the glass. After ...procedure. Additionally, purified DNA was free of agarose and could be digested with restriction enzymes....purification Starting material: PCR product or agarose gel slices Product: purified PCR product or DNA...
  4. Plasmids 101: CcdB - The Toxic Key to Efficient Cloning

    Type
    Blog Post
    ...stated, ccdB makes cloning easier by selecting against vectors that did not take up your insert. But exactly...antitoxin protein (CcdA) that protects the cell against the toxic CcdB. Cells that lose ccdA through the...expressed the ccdB gene and were therefore unable to propagate because CcdA wasn’t available to counteract the...allowing cells expressing the recombinant plasmid to propagate. Any cells that contained non-recombinant vectors...advantage of the same principle that cells will not propagate while expressing the gene. Briefly, the vector...DB3.1 or ccdB SurvivalTM, one can efficiently propagate and prep plasmids containing the ccdB gene, which...are F’. These strains could possibly be used to propagate and prep your ccdB-containing empty backbones ...
  5. Plasmids 101: Dimers and Multimers

    Type
    Blog Post
    ... uncut DNA control: a band or two appear on an agarose gel at notably higher molecular weights than expected...Plasmid Multimers Run an undigested plasmid on agarose gel Running undigested DNA on a gel as a control...same fragment sizes and banding patterns on an agarose gel as the monomeric version. However, undigested...than monomers and will therefore run higher on an agarose gel (Bedbrook & Ausubel, 1976). In fact, if your... how different plasmid conformations run on an agarose gel). If the presence of a multimer in your sample...digestion and then run the linearized plasmid on an agarose gel. You can then gel extract the linearized band...Analysis of DNA topoisomers, knots, and catenanes by agarose gel electrophoresis. Methods Mol Biol. 2009;582...
  6. Mycoplasma Contamination: Where Does It Come From and How to Prevent It

    Type
    Blog Post
    ... culture. Reusing the same bottle of serum again and again for each subculture can enhance the growth ...liquid broth and on the agar plates. Mycoplasma colonies are easily visible on the agar plates. This method...based detection, DNA staining, fluorescent tagging, agar plating, etc. Be wise to choose any of the techniques...sampling (Uphoff and Drexler, 2011). Culturing on agar plates/broth is considered the ‘gold standard’ for...Cyclin, fluoroquinolone ciprofloxacin, ciprobay, zagam, baytril, tetracycline, etc. are available for mycoplasma...
  7. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ....2842  Soldner, F., Laganière, J., Cheng, A. W., Hockemeyer, D., Gao, Q., Alagappan, R., Khurana, V., Golbe...itself, will protect the HR template from the Cas9. Again, if it's within coding region make sure it's a silent...Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16: Why does the PX260 plasmid use 30 ....08.021  Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A., & Zhang, F. (2013). Genome ...
  8. The Stingy Scientist: How the Baby Gel Box Was Born

    Type
    Blog Post
    ...so the agarose doesn’t pour over the sides.  These tiny gels and tiny lanes required less agar, less ethidium...own glass milk for purifying cut plasmid DNA from agar slices.  Molecular biologists used this procedure...project started when I realized I was pouring large agarose gels for DNA visualization or isolation, then using...using glass slides. With just the right amount of agarose, I could pour a very thin gel on a large glass ...
  9. CRISPR Antimicrobials

    Type
    Blog Post
    ...antimicrobials could become our newest line of defense against bacteria. Created with BioRender.com. ...resistant bacteria, allowing them to multiply and propagate their resistance genes. Our society is hoping ... just the method needed to jumpstart the fight against antibiotic resistance. Advantages of CRISPR over...targeted two distinct beta-lactam resistance genes, again with very high specificity. This double phage system...strategy can help us win back ground in the fight against bacterial superbugs. References 1. Citorik, Robert...
  10. Plasmids 101: Choosing an Antibiotic Resistance Gene

    Type
    Blog Post
    ...express a gene contained in a plasmid. During the propagation and/or transformation process, some bacteria ...known to produce satellite colonies when used on agar plates due to the fact that beta-lactamase is excreted...transformations. Cons: Prone to satellite colony formation on agar plates, less stable at high temperatures and in ...environments and is less susceptible to degradation in agar plates. This prevents satellite colonies from forming...Addgene’s Basic Molecular Biology Protocols Over-Agar Antibiotic Plating Plasmids 101 eBook Resources...
  11. 2018 #DeckTheLab Contest Winners

    Type
    Blog Post
    ...neurons on the lab door, and lot of agar art. This collection of agar art from Nika Heijmans stood out to...out of the bunch and here’s what ended up on top. Agar art from Nika Heijmans There were many science-themed... to the Addgenies. Happy holidays!🎄☃️ More #agarart from our lab @SILS_UvA 🧬🧫 Soon on display @Micropia...
  12. The Developmental Studies Hybridoma Bank: Over 25 Years of Antibody Sharing

    Type
    Blog Post
    ...hybridoma lines, each producing a monoclonal antibody against a target antigen. This contrasts with polyclonal...popular monoclonal antibodies include those directed against human transcription factors such as PAX7, PAX6,... addition, we distribute monoclonal antibodies against popular fluorescent proteins (GFP and YFP) and ... high profile antigens; and 4) generating mAbs against new cancer biomarkers. We believe that repositories...
  13. The Strength of Story Telling

    Type
    Blog Post
    ...is to keep working on telling a story again and again and again until you work out what people enjoy and...Jack Leeming Editor of Naturejobs, part of Nature magazine. Humans are built to enjoy, remember, and listen...
  14. RANbodies: Reporter Nanobody Fusions

    Type
    Blog Post
    ...RANbody plasmids from Yamagata et al can be found here. Can’t find a RANbody against your favorite protein...single domain antibody. To create their RANbodies, Yamagata et al used previously published nanobody sequences...the comments below. References Sanes, J.R., & Yamagata, M. (2018). Reporter-nanobody fusions (RANbodies...
  15. Antibodies 101: Secondary Antibodies

    Type
    Blog Post
    ...  Secondary antibodies are antibodies generated against antibody isotypes from a specific species, such...possible to get secondary antibodies generated against isotype subclasses, such as mouse IgG2 or IgG4....unbound or excess antibody. Incubate the sample again with a conjugated secondary antibody, which will...anti-rabbit?!”*  *a secondary antibody generated in goat against rabbit immunoglobulins. References and Resources...
  16. Science communication: 9 Strategies to Get Your Foot in the Door

    Type
    Blog Post
    ...draw live sketches at conferences like @ATJCagan or create agar art with colorful microbes? Try your hand...learning on the job. Try to get an internship at a magazine or newspaper (here’s a partial list). A great ...Schmidt! Sarah Schmidt is engineering resistance against Fusarium wilt disease in bananas as a Marie Curie...
  17. Antibodies 101: ELISA (Enzyme-linked Immunosorbent Assay)

    Type
    Blog Post
    ...it can also be used to characterize antibodies against the antigen bound to the plate. Figure 3...absorbed by a solution - of these wells is plotted against the known protein concentration. Importantly, you...: A standard curve is generated by plotting OD against known concentrations of your target protein. The...calculate the protein concentration. Image from Jagarlamudi et al., 2015.   The maximum OD that most ...
  18. Antibodies 101: Flow Compensation

    Type
    Blog Post
    ...and how do I fix it? When plotting two channels against each other, you should be able to draw perpendicular...single-color APC control, with APC and APC-CY7 plotted against each other. Since it is a single-color control,...After increasing the compensation values for APC against APC-Cy7, the populations are in more of a straight...compensation value of five was applied to APC-Cy7 against APC to correct for this bleed. A compensation value...
  19. Tips for arabidopsis transformation

    Type
    Blog Post
    ...couple of my favorites. Plasmids from the Tsuyoshi Nakagawa lab are binary gateway vectors and can be used...(basta, hygromycin, kananamycin, tunicamycin) (Nakagawa et al., 2007). Alternatively, if you prefer Golden... let them recover for a week, and then dip them again.  This won’t hurt them, and it will increase the...25902487. PubMed Central PMCID: PMC4426443. 4. Nakagawa, T. et al. (2007) ‘Improved Gateway Binary Vectors...
  20. Bacterial Toxin-antitoxin Systems as Molecular Biology Tools

    Type
    Blog Post
    ...pieces of DNA whose sole purpose is to ensure the propagation of themselves and their associated genes. These...first discovered in 1983 when Teru Ogura and Sota Hiraga found that if a mini-F plasmid carried a specific...specific 700 bp segment of DNA, the plasmid was propagated better than plasmids without this DNA. They eventually...biological inquiries. References Ogura, Teru, and Sota Hiraga. "Mini-F plasmid genes that couple host cell division...
Showing: 41 - 60 of 398 results