We narrowed to 55 results for: chia

...Thermus thermophilus DNA ligase, a homolog of Escherichia coli DNA ligase." Journal of bacteriology 173.16...

...knows how the physical kits are made and shipped; Chiara, the tech transfer expert who understands the somewhat...

... and approaches for optogenetics." Biological psychiatry 71.12 (2012): 1033-1038. PubMed PMID: 22480664...

...system for CRISPR-Cas9-assisted genome editing in Escherichia coli. Acta Biochimica et Biophysica Sinica. https...

...have been created by directed evolution of the Escherichia coli TadA, a tRNA adenine deaminase. Like cytosine...

...codon-optimized the Open Enzymes parts for expression in Escherichia coli . Researchers can use the collection as ...

...Methyl-CpG binding protein 2. Am J Med Genet B Neuropsychiatr Genet . 180, 55–67. PMID: 30536762 Shahbazian...

...hypothalamus-habenula circuit controls aversion. Mol. Psychiatry 24(9):1351-1368. PubMed (Link opens in a new ...

...for alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product....

...genome-engineering endeavours of unparalleled complexity in Escherichia coli, like the construction of a so-called “genomically...

...UGA). The amber codon is the rarest codon in Escherichia coli , which makes it the most commonly used ...

...have been created by directed evolution of the Escherichia coli TadA, a tRNA adenosine deaminase. Like cytosine...

...GCAAATGGCATTCTGACATCC For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with...CAATTTACATCTTTATTTATTAACG For Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors...

...be used with plasmids from the MoClo-YTK . MoClo Pichia Toolkit Yeast Expression Volker Sieber Plasmids...

...have been created by directed evolution of the Escherichia coli TadA, a tRNA adenosine deaminase. Like cytosine...