We narrowed to 57 results for: chia
-
TypeBlog Post...Thermus thermophilus DNA ligase, a homolog of Escherichia coli DNA ligase." Journal of bacteriology 173.16...
-
FLEx Technology and Optogenetics: Flipping the switch on gene expression with high spatial and temporal resolution
TypeBlog Post... and approaches for optogenetics." Biological psychiatry 71.12 (2012): 1033-1038. PubMed PMID: 22480664... -
Transferable Skills Guide: Teamwork
TypeBlog Post...knows how the physical kits are made and shipped; Chiara, the tech transfer expert who understands the somewhat... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Mammalian/Lentiviral BbsI none S. pyogenes Puro Ochiai pSB700 64046 Mammalian/Lentiviral none S. pyogenes...simultaneously repressing multiple target genes in Escherichia coli. Koffas Do you have suggestions for other... -
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More
TypeBlog Post...system for CRISPR-Cas9-assisted genome editing in Escherichia coli. Acta Biochimica et Biophysica Sinica. https... -
CRISPR Plasmids - Base Edit
TypeCollection...have been created by directed evolution of the Escherichia coli TadA, a tRNA adenine deaminase. Like cytosine... -
Open Enzyme Collection
TypeCollection...codon-optimized the Open Enzymes parts for expression in Escherichia coli bacteria. Researchers can use the collection... -
27 Hot Plasmids from 2016
TypeBlog Post...genome-engineering endeavours of unparalleled complexity in Escherichia coli, like the construction of a so-called “genomically... -
Rett Syndrome
TypeCollection...Methyl-CpG binding protein 2. Am J Med Genet B Neuropsychiatr Genet . 180, 55–67. PMID: 30536762 Shahbazian... -
Deisseroth INTRSECT Collection
TypeCollection...hypothalamus-habenula circuit controls aversion. Mol. Psychiatry 24(9):1351-1368. PubMed (Link opens in a new ... -
CRISPR History and Development for Genome Engineering
TypeCollection...for alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product.... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...of PCR products. Finney M, Nisson PE, Rashtchian A. Current Protocols in Molecular Biology. 2001... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...Szelenyi ER, Trader C, Balaram P, van Velthoven CTJ, Chiang M, Mich JK, Dee N, Goldy J, Cetin AH, Smith K, ... -
Sequencing Primers
TypeGuide...List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'...5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward primer 35S promoter...Forward CAATTTACATCTTTATTTATTAACG (Invitrogen) For Pichia vectors with AUG1 promoter, forward primer AUG1...Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1 promoter, reverse primer BGH ... -
CRISPR Guide
TypeCollection...have been created by directed evolution of the Escherichia coli TadA, a tRNA adenosine deaminase. Like cytosine... -
Modular Cloning Guide
TypeGuide...be used with plasmids from the MoClo-YTK . MoClo Pichia Toolkit Yeast Expression Volker Sieber Plasmids... -
CRISPR Guide
TypeGuide...have been created by directed evolution of the Escherichia coli TadA, a tRNA adenosine deaminase. Like cytosine...