We narrowed to 80 results for: kan

1. Lighting Up Cell Signaling with Photoswitchable Kinases

   Type

   Blog Post

   ...References 1. Zhou, Xin X., Linlin Z. Fan, Pengpeng Li, Kang Shen, and Michael Z. Lin. "Optical control of cell...

2. Uncertainty about Labor Law Brings More Uncertainty to Postdoc Wages

   Type

   Blog Post

   ...densely populated places like the University of Kansas and the University of Louisville in Kentucky, the...

3. Teaching an Old DOG New Tricks: Controlling Protein Activity with GFP

   Type

   Blog Post

   ...133–138. PubMed PMID: 20010839. 4. Caussinus, E., Kanca, O., and Affolter, M. “Fluorescent fusion protein...

4. Plasmids 101: Golden Gate Cloning

   Type

   Blog Post

   ...method with high throughput capability. Engler C, Kandzia R, Marillonnet S. PLoS One 2008;3(11):e3647. doi...

5. Plasmids 101: In-house NGS Plasmid Quality Control Now at Addgene

   Type

   Blog Post

   ...K, Sanders E, Tasissa M, Kostman M, Tillgren M, Makana Hanley L, Mueller I, Mitsopoulos A, Fan M (2020...

6. Viral Vectors 101: Calcium Sensors

   Type

   Blog Post

   ...Neuroscience Research. 2021 Aug 1;169:2-8. Suzuki J, Kanemaru K, Iino M. Genetically encoded fluorescent indicators...

7. Quickest Way to Deposit Plasmids: The Deposit Spreadsheet

   Type

   Blog Post

   ...chloramphenicol, erythromicin, gentamicin, hygromycin, kanamycin, nourseothricin (clonNat), spectinomycin, streptomycin...

8. Tips for a 1st time AAV user (by a Rookie AAV user)

   Type

   Blog Post

   ...1, 18-28. PubMed PMID: 22428977. 2. Choi, V.W., Asokan, A., Haberman, R.A., & Samulski, R.J. (2007). Production...

9. Fluorescent Tagging of Endogenous Genes with SapTrap

   Type

   Blog Post

   ... protein characteristics. For example, Masato Kanemaki's lab has developed a CRISPR/Cas-based system for...

10. AAV Vector Quality Control: Going the Extra Mile with NGS

    Type

    Blog Post

    ...K, Sanders E, Tasissa M, Kostman M, Tillgren M, Makana Hanley L, Mueller I, Mitsopoulos A, Fan M (2020...

11. Plasmids 101: Multicistronic Vectors

    Type

    Blog Post

    ...Lentiviral AmCyan-P2A-mCherry P2A Mammalian pC5Kan-P2A P2A Insect pUltra P2A and T2A Lentiviral ...

12. Tips for arabidopsis transformation

    Type

    Blog Post

    ... plant selection markers (basta, hygromycin, kananamycin, tunicamycin) (Nakagawa et al., 2007). Alternatively...

13. MXS Chaining

    Type

    Blog Post

    ...PubMed Central PMCID: PMC2822740. 2. Engler C, Kandzia R, Marillonnet S. A one pot, one step, precision...

14. Tips from the Repository Trenches: Using Barcodes to Track Samples

    Type

    Blog Post

    ...majority of plasmids contain either an ampicillin or kanamycin resistance gene. Every step along the way involves...

15. Harnessing TnpB for Genome Editing: A Compact and Versatile Tool for Your Research

    Type

    Blog Post

    ...resistance gene as the plant-selectable marker and a kanamycin resistance gene for bacterial selection. The process...

16. Plasmids 101: Shuttle Vectors

    Type

    Blog Post

    ...aminoglycosides work on different host species: kanamycin targets the prokaryotic ribosome, while G418 (...

17. Hot Plasmids: Fall 2024

    Type

    Blog Post

    ...tetracycline repressor TetR and resistance selection marker KanR. This strain is then transformed with the sgRNA ...

18. Neuronal labeling with Spaghetti Monster

    Type

    Blog Post

    ...design in public schools and was started in 2005 in Kansas by Bobby Henderson, a physics graduate from Oregon...

19. Plasmids 101: E. coli Strains for Protein Expression

    Type

    Blog Post

    ... General protein expression  m15 pREP4*, ** Kanamycin (pREP4) Cis-repression of the E. coli T5 promoter...

20. Validated gRNA Sequences

    Type

    Collection

    ...TATTAAATGCAGATAACCT 66089 cut S. pyogenes 25249454 Seydoux KANK3 H. sapiens GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes...GGGGCCACTAGGGACAGGAT 72833 cut S. pyogenes 27052166 Kanemaki mmp21 D. rerio CGGAGCTGATCACTGACA 72890 cut S....