We narrowed to 15 results for: kan
-
TypeCollection...Methylobacterium extorquens Julia Vorholt 84693 pMyNT-kan Acetamidase promoter Acetamide Escherichia coli ,...Mycobacterium smegmatis Matthias Wilmanns 84692 pMyC-kan Acetamidase promoter Acetamide Escherichia coli ,...Mycobacterium smegmatis Matthias Wilmanns 84689 pMyBADC-kan pBAD Arabinose Escherichia coli , Mycobacterium smegmatis...) Escherichia coli Cynthia Collins 84689 pMyBADC-kan pBAD Arabinose Escherichia coli , Mycobacterium smegmatis...
-
Zinc Finger Consortium: OPEN Reagents
TypeCollection... as stabs at room temperature. ID Name 13421 pAC-Kan-alphaGal4 13422 pBAC-lacZ 13424 KJBAC1 strain 21869... -
CRISPR Plasmids - Plants
TypeCollection... Yang 62202 pKSE401 AtU6-26 yes, cut S. pyogenes Kan Chen 50929 pRGE31 rice snoRNA U3 BsaI none S. pyogenes... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Clover - Mammalian Expression pFA6a-link-yoClover-Kan - Yeast Expression dClover2 505 515 Dimer (A206K)...C1 - Mammalian Expression pFA6a-link-yoTagRFP657-Kan - Yeast Expression smURFP 642 670 32 3.2 39 min Prone...pRSETA-PAGFP - Bacterial Expression pFA6a-PA-GFP-kanMX6 - Yeast Expression pFA6a-link-yEPAGFP-CaUra3 - ...on our blog . Protein Ligand Plasmids HaloTag Chloralkane (CA) pMH-Halo tag - Mammalian Gateway Destination... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Basta Chen pKSE401 62202 Plant yes, cut S. pyogenes Kan Chen pHUE411 62203 Plant yes, cut S. pyogenes Hyg...Jackson pMZ376 74213 Yeast rrk1 yes, cut S. pyogenes KanMX Zaratiegui pMZ377 74214 Yeast rrk1 yes, cut S. pyogenes... -
Structural Genomics Consortium Plasmids
TypeCollection...cleavage, KanR 26101 pET28GST-LIC EF456739 GST-tag and hexahistidine tag with Thrombin cleavage, KanR 26096...cleavage, KanR 26105 pNIC-CTHF EF199844 Hexahistidine tag, FLAG tag with TEV cleavage, KanR 26106 pNH-...MHL EF456735 Hexahistidine tag with TEV cleavage, KanR 26098 pCW-LIC EF460848 No tag, double ptac promoter...Hexahistidine tag, thioredoxin with TEV cleavage, KanR 26107 pNIC-ZB GU452710 Hexahistidine tag , Z-basic... -
Botman-Teusink Yeast FP Collection
TypeCollection... 2013), and are available with URA3, SpHIS5 and KANMX markers. The FP together with the protothropic cassette...) containing the TEF1 or PGK1 promoters and the KanMX marker. ID Plasmid Gene/Insert Selectable Marker... -
CRISPR Plasmids - Tagging
TypeCollection... CRISPR/Cas Toolkit Kanemaki Lab Auxin-Inducible Degron Tagging Masato Kanemaki's lab has developed a ... -
Validated gRNA Sequences
TypeCollection...TATTAAATGCAGATAACCT 66089 cut S. pyogenes 25249454 Seydoux KANK3 H. sapiens GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes...GGGGCCACTAGGGACAGGAT 72833 cut S. pyogenes 27052166 Kanemaki mmp21 D. rerio CGGAGCTGATCACTGACA 72890 cut S.... -
CRISPR Plasmids - Bacteria
TypeCollection...NGG) 42875 pCRISPR BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection...4215-4231. PMID: 26865709 Other citations include: Kanaan, et al. 2017. Rationally Engineered AAV Capsids... -
Fluorescent Proteins: FRET
TypeCollection...128,000 0.45 6.4 4.9 pNCS-mClover3 , pNCS-mRuby3 , pKanCMV-mClover3-mRuby3 mNeonGreen mRuby3 506 0.80 592 ... -
Rett Syndrome
TypeCollection... (Link opens in a new window) PMID: 6638958 Kankirawatana et al. 2006. Early progressive encephalopathy... -
Deisseroth INTRSECT Collection
TypeCollection...AC, Tepler S, Poulin JF, Ansorge M, Awatramani R, Kang UJ, Rayport S. 2018. Dopamine neuron glutamate cotransmission... -
Tetracycline Inducible Expression
TypeCollection...conditional auxin-inducible degron system Masato Kanemaki 92099 AAVS1_Puro_Tet3G_3xFLAG_Twin_Strep Tet-inducible...