We narrowed to 85 results for: tet on vector

...on the Addgene blog Viral Vectors 101: An Introduction to AAV Viral Vectors 101: The AAV Retrograde Serotype...Using AAV vectors in complex biological systems can be tricky at best, and downright infuriating at worst...testing, and optimizing three key variables of an AAV vector: serotype, promoter, and titer.     Figure...efficacy. You’ll therefore need to test potential AAV vectors in your specific experimental system, rather than...check for this in your system and then test each vector before starting your experiments (Rolland et al...sure to test for this when validating your viral vector. Titer Once you have selected potential serotypes...off-target effects (e.g. recombinase-dependent vectors) increases with the amount of virus you add, so...

...AAV1 pAAV-ihSyn1-DIO-tTA Viral vectors coming soon! These vectors listed below should be released at... of our viral vectors blog posts Find tips for preparing AAVs Download our viral vectors 101 eBook Resources...new tools to our inventory of ready-to-use viral vectors. Here are some of the AAV we have released in the...AAV pEF1a-DIO-FLPo-WPRE-hGHp Other new viral vectors New optogenetics inhibitors Plasmid Serotype...for order please email [email protected] with the vector name and serotype you’d like to be notified about...  AAV5 ppAAV-CKIIa-stGtACR1-FusionRed New tetracycline transactivators Plasmid Serotype Name 99120...

...communication. Viral vectors and the nervous system With the advent of viral vector technology, new methods... at Addgene). AAV vectors: A platform for delivering neuronal tracers AAV vectors have been widely used...genome is a single-stranded DNA molecule and AAV vectors are replication deficient (i.e. they cannot easily... low immunogenicity and cellular toxicity. AAV vectors can be equipped with strong promoters for high ... is often made Cre-dependent. If Cre-dependent vectors are used in transgenic animals that express Cre...that also express Cre. Another advantage of AAV vectors is that there are well-established protocols for...life cycle. Using AAV for neuronal tracing AAV vectors are the first choice of many neuroscientists, with...

...cloning vectors such as pBR322, pACYC, and pUC were developed to provide higher copy number vectors that ...successful, pSC101 became the first plasmid cloning vector and molecular biology was never the same. Over ...the "Plasmids that Glow" and "Viral Expression Vectors" chapters, and more pictures and pro tips.  Happy...experiment. Dr. Cohen and colleagues treated a tetracycline resistant plasmid, pSC101, and a newly developed...

...biosensor affinity for calcium.”  Primary Vector Type The vector type should describe how your plasmid ...indicate type in “Vector Type Other” column. For example, you may enter “donor template vector”. Cloning...plasmids containing the ccdB gene, such as Gateway vectors, choose the ccdB Survival strain. For plasmids ...nourseothricin (clonNat), spectinomycin, streptomycin, tetracycline, combinations of the above, or other. High...

...cells Peter Cockerill 212936 pGL3 Basic Vector Firefly Vector for investigating regions controlling transcription...pCW57.1-Luciferase Firefly TRE Lentiviral vector with dox- or tet-inducible luciferase expression Stephen...Scott Lowe 21375 pHIV-Luciferase Firefly Lentiviral vector for insertion of your gene of interest upstream...and renilla_polyA Firefly, Renilla Dual reporter vector. Insertion of 5' promoter/enhancer regions upstream...212935 pGL4.84(hRlucCP/Puro) RapidResponse™ Renilla Vector for investigating regions controlling transcription... Pete Stecha 212933 pGL4.82(hRluc/Puro) Renilla Vector for investigating regions controlling transcription...pGL4Luc-RLuc Firefly, Renilla Dual reporter reporter vector allowing the study of biscistronic promoters. Daniel...

...plant We developed plant adenine base editor (ABE) vectors to install A>G or T>C mutations in the plant genome...genome. We constructed three versions of the vector (pKABE6.3, pKABE7.9, and pKABE7.10) so that the user...are better suited (Gaudelli et al., 2017). Our vectors have two Bsa1 sites to clone the single guide RNA... genomic site simultaneously.     These binary vectors could be used to generate stable genome edited ...Agrobacterium-mediated transformation. We also constructed smaller vectors suitable for transient assays using protoplast ...et al., 2016) invented CRISPR-base editors by tethering cytosine deaminase with Cas9 nickase (nCas9). ...

...Recently the Vellai lab has created an improved RNAi vector that leads to significantly stronger phenotypes...for mutant genetic backgrounds. The standard RNAi vector, L4440, places a target gene between two inverted...complexes with LacZ𝜔 and forms an active LacZ tetramer.  This tetramer cleaves chlorophenol red-b-D-galactopyranoside...

...fusions for membrane display, they recommend the NGR vectors for most experiments. These new tools promise to... toolkit is the empty plasmid backbone: the DNA vector that contains everything needed to replicate inside...successful experiments or therapies. Using AAV vectors with enhancers that drive cell-type-specific expression...colleagues characterized a series of new enhancer-AAV vectors targeting specific classes of cortical and striatal... glycosaminoglycans (GAG), and are (typically) tethered to the cell surface by a GPI-anchor. Image courtesy...

... construct. This strategy can be used to build vectors with diverse functions, and thus, is used in many...Shetty RP, Endy D, Knight TF. Engineering BioBrick vectors from BioBrick parts. Journal of biological engineering... fluorescent protein were fused in-frame to a tethering partner, which directed localization of the fluorophore...Construct Fluorophore Excitation/emission maxima Tethering partner Subcellular localization 1 TagBFP 399nm...

... 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD ...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1...Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...For pBluescript vector Forward pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector Reverse pBMN 5' ...

...Controlled Expression Resources Check out our Tetracycline (Tet) Inducible Expression Collection for an extensive...selection of mammalian and bacterial FRET-related vectors and standards. The Hoschschild Bacterial Two-Hybrid...FRET-based Biosensors Kit (Addgene #1000000021) is a vector library for the generation of FRET biosensors for...#1000000222) is a collection of Golden Gate compatible vectors for bimolecular fluorescence complementation experiments...Expression Species PI 44249 pdCas9-bacteria pTetO Anhydrotetracycline (aTc) Escherichia coli Stanley Qi 11518...coli Andreas Moeglich 68940 pRMC2 Pxyl/TetO Anhydrotetracycline (aTc) Staphylococcus aureus Tim Foster...glutamicum Timothy Lu 17972 pSE100 Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium...

...lab developed new fluorescently labeled piggyBac vectors to deliver uniform and sustained expression of ... RNA-guided methylcytosine editing by TET1 by co-delivering TET1 and protein factors for linking methylcytosine...., 2019. Fusing epigenetic modifiers such as TET1 with inactive Cas enzymes can alter gene expression...

... means they can be delivered in vivo using AAV vectors. Having a way to shut off CRISPR-Cas systems prevents...Papayannopoulou T, Lieber A (2018) HDAd5/35++ Adenovirus Vector Expressing Anti-CRISPR Peptides Decreases CRISPR...Acr proteins can also be used to prevent dCas9 tethering to DNA. Since these early anti-CRISPR studies,...

...successful cloning. In these instances, the cloning vector typically has two separate resistance cassettes...permeability Bactericidal 10-100 ug/mL Tetracycline tetracyclin Binds 30S ribosomal subunit; inhibits...in foil if a light-sensitive antibiotic like Tetracycline is used. Keep in mind that some E. coli strains...

...their gene of interest into a previously deposited vector - then you'll find the plasmids listed below the...new feature in action, click here to explore the TetO-FUW-OKSM plasmid page. Or search for your favorite...

...Zhang showed they could package LITEs in viral vectors and genetically target them to specific cell populations...chromophores flavin-adenine dinucleotide and methyltetrahydrofolate, which are universally abundant. Second...

...The gRNA oligos are subsequently cloned into your vector of choice using the adapter sequences that you ...Neville E., Ophir Shalem, and Feng Zhang. "Improved vectors and genome-wide libraries for CRISPR screening....CMM), Department of Medicine, Solna, Karolinska Institutet, in Sweden. It can be very time consuming to ...CMM), Department of Medicine, Solna, Karolinska Institutet, in Sweden. He has a particular interest in using...

...pAAV-hSyn-dF-HA-KORD-IRES-mCitrine AAV packaging vector for hSyn driven KOR DREADD expression. Bryan Roth...neuronal soma and proximal dendrites in a viral vector Hillel Adesnik 107708-AAV9 pAAV-hSynapsin- soCoChR-GFP...separated from nuclear mRuby3 by P2A in a viral vector Hillel Adesnik 109048-AAV9 pAAV-CAG-DIO-NLS-mRuby3... of internal ribosome entry sequence in a viral vector Hillel Adesnik 111066-AAV1 pAAV-hSyn-dLight1.1 ...Gradinaru 117383-AAV1 TRE-DIO-eYFP An AAV genome with tet-inducible, Cre-dependent expression of the fluorescent...Podgorski 135630-AAV1 pAAV-S5E2-dTom-nlsdTom AAV vector to drive the expression of dTomato in PV cortical...Dimidschstein 135630-AAV9 pAAV-S5E2-dTom-nlsdTom AAV vector to drive the expression of dTomato in PV cortical...

... Addgene's viral vectors articles Find tips and tricks for working with viral vectors Resources on Addgene.org...fluoroquinolone ciprofloxacin, ciprobay, zagam, baytril, tetracycline, etc. are available for mycoplasma removal from...