...communication. Viral vectors and the nervous system With the advent of viral vector technology, new methods... at Addgene). AAV vectors: A platform for delivering neuronal tracers AAV vectors have been widely used...genome is a single-stranded DNA molecule and AAV vectors are replication deficient (i.e. they cannot easily... low immunogenicity and cellular toxicity. AAV vectors can be equipped with strong promoters for high ... is often made Cre-dependent. If Cre-dependent vectors are used in transgenic animals that express Cre...that also express Cre. Another advantage of AAV vectors is that there are well-established protocols for...life cycle. Using AAV for neuronal tracing AAV vectors are the first choice of many neuroscientists, with...

...Biosafety Guide Lentiviral Plasmids AAV Plasmids Viral Vectors 101 eBook γ-Retrovirus (gamma-retrovirus) is an...retroviral plasmid Vignali 27995 TtRMPVIR CMV/MSV Tet-regulated expression of shRNA; expresses rtTA. See...resistance. Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in...

...cloning vectors such as pBR322, pACYC, and pUC were developed to provide higher copy number vectors that ...successful, pSC101 became the first plasmid cloning vector and molecular biology was never the same. Over ...the "Plasmids that Glow" and "Viral Expression Vectors" chapters, and more pictures and pro tips.  Happy...experiment. Dr. Cohen and colleagues treated a tetracycline resistant plasmid, pSC101, and a newly developed...

...biosensor affinity for calcium.”  Primary Vector Type The vector type should describe how your plasmid ...indicate type in “Vector Type Other” column. For example, you may enter “donor template vector”. Cloning...plasmids containing the ccdB gene, such as Gateway vectors, choose the ccdB Survival strain. For plasmids ...nourseothricin (clonNat), spectinomycin, streptomycin, tetracycline, combinations of the above, or other. High...

...plant We developed plant adenine base editor (ABE) vectors to install A>G or T>C mutations in the plant genome...genome. We constructed three versions of the vector (pKABE6.3, pKABE7.9, and pKABE7.10) so that the user...are better suited (Gaudelli et al., 2017). Our vectors have two Bsa1 sites to clone the single guide RNA... genomic site simultaneously.     These binary vectors could be used to generate stable genome edited ...Agrobacterium-mediated transformation. We also constructed smaller vectors suitable for transient assays using protoplast ...et al., 2016) invented CRISPR-base editors by tethering cytosine deaminase with Cas9 nickase (nCas9). ...

...Recently the Vellai lab has created an improved RNAi vector that leads to significantly stronger phenotypes...for mutant genetic backgrounds. The standard RNAi vector, L4440, places a target gene between two inverted...complexes with LacZ𝜔 and forms an active LacZ tetramer.  This tetramer cleaves chlorophenol red-b-D-galactopyranoside...

... construct. This strategy can be used to build vectors with diverse functions, and thus, is used in many...Shetty RP, Endy D, Knight TF. Engineering BioBrick vectors from BioBrick parts. Journal of biological engineering... fluorescent protein were fused in-frame to a tethering partner, which directed localization of the fluorophore...Construct Fluorophore Excitation/emission maxima Tethering partner Subcellular localization 1 TagBFP 399nm...

...motor neuron-specific reporter and a PAX7 inducible vector . Harley et al. Cell Rep. 2023 Dec 26. Induce CNS... bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression of transcription factors for...with rapid delivery. Includes antibodies, viral vectors, animal models, purified protein, and more. Plasmids...

...lab developed new fluorescently labeled piggyBac vectors to deliver uniform and sustained expression of ... RNA-guided methylcytosine editing by TET1 by co-delivering TET1 and protein factors for linking methylcytosine...., 2019. Fusing epigenetic modifiers such as TET1 with inactive Cas enzymes can alter gene expression...

... means they can be delivered in vivo using AAV vectors. Having a way to shut off CRISPR-Cas systems prevents...Papayannopoulou T, Lieber A (2018) HDAd5/35++ Adenovirus Vector Expressing Anti-CRISPR Peptides Decreases CRISPR...Acr proteins can also be used to prevent dCas9 tethering to DNA. Since these early anti-CRISPR studies,...

...successful cloning. In these instances, the cloning vector typically has two separate resistance cassettes...permeability Bactericidal 10-100 ug/mL Tetracycline tetracyclin Binds 30S ribosomal subunit; inhibits...in foil if a light-sensitive antibiotic like Tetracycline is used. Keep in mind that some E. coli strains...

...expression vector Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 ... in a single lentiviral transfer vector or separate transfer vectors May contain reporter gene (e.g. GFP...lines (for details, see Plasmids 101: Mammalian Vectors ) Transient or stable expression of Cas9 and/or...CRISPR elements are inserted into an AAV transfer vector and used to generate AAV particles (for details...oligos and clone these oligos into your desired vector. In many cases, targeting oligos are synthesized... exact cloning strategy will depend on the gRNA vector you have chosen, so it is best to review the protocol...

...their gene of interest into a previously deposited vector - then you'll find the plasmids listed below the...new feature in action, click here to explore the TetO-FUW-OKSM plasmid page. Or search for your favorite...

...Zhang showed they could package LITEs in viral vectors and genetically target them to specific cell populations...chromophores flavin-adenine dinucleotide and methyltetrahydrofolate, which are universally abundant. Second...

...The gRNA oligos are subsequently cloned into your vector of choice using the adapter sequences that you ...Neville E., Ophir Shalem, and Feng Zhang. "Improved vectors and genome-wide libraries for CRISPR screening....CMM), Department of Medicine, Solna, Karolinska Institutet, in Sweden. It can be very time consuming to ...CMM), Department of Medicine, Solna, Karolinska Institutet, in Sweden. He has a particular interest in using...

... Addgene's viral vectors articles Find tips and tricks for working with viral vectors Resources on Addgene.org...fluoroquinolone ciprofloxacin, ciprobay, zagam, baytril, tetracycline, etc. are available for mycoplasma removal from...

... a) Cells are transfected with three different vectors and flow cytometry is used to sort populations ...the expression of fluorescent proteins and oxytetracycline enzymes. Next, this system was used to recreate...

...pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors, reverse... in pBABE vectors, forward primer pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli...TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector pBMN 5' GCTTGGATACACGCCGC... in pcDL vector, forward primer pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector, forward ...attL2 in pENTR vector, reverse primer pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX vectors, reverse primer... tdTomato, reverse primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer... Lab) Psi packaging signal, 5' of MCS in pBABE vectors, forward primer pGEX 5' GGGCTGGCAAGCCACGTTTGGTG...

...tracrRNA was combined with the sgRNA expression vector allowing the screen to be conducted with only two...while nuclease-deactivated Cas9 (dCas9) can be tethered to a repressor (CRISPRi) or an activation domain...RNA-guided DNA binding protein (dCas9). dCas9 is then tethered to a repressive domain, such as KRAB, to prevent...

...to drive cell type-specific delivery of a viral vector (Strebinger et al., 2023). All this flexibility...a look at some popular self-labeling tools: Tetracysteine: The first reported chemical labeling tag, from...Commercial ligands available Ease of use Tetracysteine (Cys4) 15 Biarsenical dyes (FlAsH, ReAsH...labeling specificity than short peptide tags like tetracysteine (Jing & Cornish, 2011). HaloTag and SNAP-tag...functional. In some cases, a small peptide tag like tetracysteine might be the only option that doesn’t disrupt...options for CLIP-tag and very few TMP-tag or tetracysteine labeling dyes.  If reaction speed is a priority...