Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 772 results for: LIS

Showing: 601 - 620 of 772 results

  9. Ras Pathway

    Type
    Collection
    ...Pathway Background Ras Pathway Plasmids Ras Gene List Resources Background Ras is a small GTPase and is...available plasmids for the gene, or browse the gene list below. For proteins with multiple subunits or isoforms...Cancer Research Return to top Ras Pathway - Gene List Click on a name to find available plasmids for the... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...

  10. Validated gRNA Sequences

    Type
    Collection
    ... Design Tools CRISPR Blog Posts The table below lists gRNA sequences that have been experimentally validated...experiment as described in the associated article (listed below by PubMed ID). These factors include: Does...the Cas9 application the gRNA was designed to accomplish. Validated gRNA Sequence Datatable Target Gene... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...

  13. Lab Automation at Addgene

    Type
    Blog Post
    ... of pushing them in one by one. It seems very simplistic and it isn’t electronic but it is one of the ...

  14. Hot Plasmids February 2024

    Type
    Blog Post
    ...original, though its maturation is even faster. Published just a few days later, Mohan Balasubramanian and...

  15. A Look at Addgene's QC Process

    Type
    Blog Post
    ...Any tags, selectable markers, and fusion proteins listed for each plasmid  If the plasmids pass all inspection...
Showing: 601 - 620 of 772 results