... of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse primer...

... transfected using 1:1, 1:2, 1:3 and 1:6 µg of pRosetta :µg of PEI. The 1:2 and 1:3 ratios provided high...

..., D., Romanel, A., Demichelis, F., Inga, A., & Cereseto, A. (2018). A highly specific SpCas9 variant is...Protocols in Molecular Biology . 115 . PMID: 27366891 Rousset, F., Cui, L., Siouve, E., Becavin, C., Depardieu... M. W., Yamano, T., Nishimasu, H., Nureki, O., Crosetto, N., & Zhang, F. (2017). Engineered Cpf1 variants...

...were transfected with the GFP-expression plasmid pRosetta using μg total DNA to μg PEI ratios of 1:1, 1:...

...indicated serial dilutions of the lentiviral vector pRosetta . The following day, cells were treated with puromycin...

...especially in the corner of the well as cells tend to settle there. Once the cells have expanded but before ...

...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB survival strain...

...and inhibiting DREADDs in the same experimental setup) were not possible. To overcome this limitation,...

...below, can be targeted and expressed in specific subsets of neurons, allowing precise spatiotemporal control...