We narrowed to 622 results for: Set;

...screen multiple colonies before selecting a smaller subset to sequence. Sequencing gels and next-generation...

...cases, you should validate it for your particular setup. We recommend starting by searching the literature...

...course of infection, when HIV-1 is limited to a subset of T-cells, but it is unclear if enough T-cells...

...insertions such as fluorescent proteins or selection cassettes. This class of template should have homology arms...

...training in the academic research environment is setup to prepare trainees for further work in academia...

...Figure 1: Example of an experimental optogenetic setup. A light source delivers light pulses to the subject...

...adeno-associated viral vector serotypes 1, 2, 5, 8 and 9 in marmoset, mouse and macaque cerebral cortex. Neuroscience...

...; font-weight: normal; text-decoration: none","font_set":"DEFAULT"},"button_hover_color":{"color":"#0052a9...

...emission depletion (STED) nanoscopy. Scale bar, 2 μm. Inset shows comparison with standard confocal microscopy...

...Imaging of the cross-presenting dendritic cell subsets in the skin-draining lymph node." Proceedings of...

...after completing her postdoctoral training from Massachusetts General Hospital and Harvard Medical School....

... pan-mutation editing Benjamin Kleinstiver (Massachusetts General Hospital / Harvard Medical School) presented...

... transfected using 1:1, 1:2, 1:3 and 1:6 µg of pRosetta :µg of PEI. The 1:2 and 1:3 ratios provided high...

...were transfected with the GFP-expression plasmid pRosetta using μg total DNA to μg PEI ratios of 1:1, 1:...

...indicated serial dilutions of the lentiviral vector pRosetta . The following day, cells were treated with puromycin...

...especially in the corner of the well as cells tend to settle there. Once the cells have expanded but before ...

...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...protein-coding genes and complex gene expression cassettes are often too big to be packaged in rAAV vectors...enough to carry the Cas9 gene and a gRNA expression cassette in one single viral particle. Vaccine Development...

..., D., Romanel, A., Demichelis, F., Inga, A., & Cereseto, A. (2018). A highly specific SpCas9 variant is...Protocols in Molecular Biology . 115 . PMID: 27366891 Rousset, F., Cui, L., Siouve, E., Becavin, C., Depardieu... M. W., Yamano, T., Nishimasu, H., Nureki, O., Crosetto, N., & Zhang, F. (2017). Engineered Cpf1 variants...

... end of Gateway cassette Forward GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette Reverse H1 TCGCTATGTGTTCTGGGAAA...

...regions between the two ITRs with a gene expression cassette that typically contains the transgene of interest...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...