Skip to main content
Addgene
Showing: 311 - 320 of 340 results
  1. Lentivirus ddPCR Titration

    Type
    Protocol
    ...tgtgccttggaatgctagt probe (FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number...untransduced control. Pro-Tip For even seeding, prepare a batch for 10 wells with 3,000,000 cells in 13.5 mL of ...
  2. Protocol - Over-Agar Antibiotic Plating

    Type
    Protocol
    ...genes, as one does not need to prepare separate batches of antibiotic-containing agar. This protocol will...concentration. Last Update: Oct. 27, 2017 Protocol Video Watch the protocol video below to learn how to spread ...
  3. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...search for 21nt sequences that match the pattern AA(N 19 ). If no suitable match is found, search for NAR(N...Select sequences that have at least 3 nucleotide mismatches to all unrelated genes. TIP: Addgene recommends...
  4. Protocol - How to Perform Sequence Analysis

    Type
    Protocol
    ...each reaction Tips and FAQs My sequence doesn’t match Addgene’s sequencing result, what should I do? Check... Check your trace file first; the apparent mismatch/mutation may be the result of a mis-called peak in...
  5. Protocol - How to Inoculate a Bacterial Culture

    Type
    Protocol
    ...overnight culture of liquid LB with bacteria. Video Watch the protocol video below to learn how to inoculate...Double check that the antibiotic in your LB media matches the antibiotic resistance on your plasmid. If the...
  6. Protocol - Bacterial Transformation

    Type
    Protocol
    ...transformations. Last Update: Nov. 13, 2017 Protocol Video Watch the protocol video below to learn how to isolate...antibiotic. The resistance gene on your plasmid must match the antibiotic on the plate. You should also add...
  7. Colony Formation Titering Assay

    Type
    Protocol
    ... dose for the colony formation assay. Prepare a batch of DMEM complete containing 10 μg/mL polybrene by...cells into each well of a 6-well dish. Prepare a batch of cells as follows: Dilute 7,000 cells into 9.45...
  8. Pipetting Protocol

    Type
    Protocol
    ... the pipette. Last Update: September 2022 Video Watch the video for tips on pipetting in the lab. Equipment...may consider using a multichannel pipette. Please watch Addgene’s protocol on multichannel pipetting to ...
  9. Protocol - How to Run an Agarose Gel

    Type
    Protocol
    ...lengths). Last Update: Feb. 20, 2018 Protocol Video Watch the protocol video below to learn how to perform...Very slowly and steadily, push the sample out and watch as the sample fills the well. After all of the sample...
  10. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...lowest dose that kills all of the cells. Prepare a batch of DMEM complete + 10 µg/mL polybrene by diluting...solution in this step. To seed the cells: Prepare a batch of cells as follows: Dilute 350,000 cells into a...
Showing: 311 - 320 of 340 results