We narrowed to 343 results for: ATC

...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...of the ORF, including the stop codon (5'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a...

...determined for each new batch of 1 mg/mL PEI prepared. There may be variation between batches of PEI depending... volumes, pH adjustment etc. Consequently, each batch needs to be validated and the best ratio of mass... PEI needs to be empirically determined. Once a batch of PEI is prepared, transfect cells with a fluorescent...

...OptiPro SFM per 10 cm dish. Pro-Tip There can be batch to batch variation when making the PEI working stock... need to be empirically determined for each new batch of 1 mg/mL PEI and for each cell line. Considerations... PEI needs to be empirically determined. Once a batch of PEI is prepared, transfect cells with a fluorescent...

...tgtgccttggaatgctagt probe (FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number...untransduced control. Pro-Tip For even seeding, prepare a batch for 10 wells with 3,000,000 cells in 13.5 mL of ...

...genes, as one does not need to prepare separate batches of antibiotic-containing agar. This protocol will...concentration. Last Update: Oct. 27, 2017 Protocol Video Watch the protocol video below to learn how to spread ...

...search for 21nt sequences that match the pattern AA(N 19 ). If no suitable match is found, search for NAR(N...Select sequences that have at least 3 nucleotide mismatches to all unrelated genes. TIP: Addgene recommends...

...each reaction Tips and FAQs My sequence doesn’t match Addgene’s sequencing result, what should I do? Check... Check your trace file first; the apparent mismatch/mutation may be the result of a mis-called peak in...

...culture of liquid LB with bacteria. Video Protocol Watch the protocol video below to learn how to inoculate...Double check that the antibiotic in your LB media matches the antibiotic resistance on your plasmid. If the...

...transformations. Last Update: Nov. 13, 2017 Protocol Video Watch the protocol video below to learn how to isolate...antibiotic. The resistance gene on your plasmid must match the antibiotic on the plate. You should also add...

... dose for the colony formation assay. Prepare a batch of DMEM complete containing 10 μg/mL polybrene by...cells into each well of a 6-well dish. Prepare a batch of cells as follows: Dilute 7,000 cells into 9.45...