We narrowed to 772 results for: LIS;

1. Validated gRNA Sequences

   Type

   Collection

   ... Design Tools CRISPR Blog Posts The table below lists gRNA sequences that have been experimentally validated...experiment as described in the associated article (listed below by PubMed ID). These factors include: Does...the Cas9 application the gRNA was designed to accomplish. Validated gRNA Sequence Datatable Target Gene... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...

2. The AAVantages of AAV in CRISPR Screens

   Type

   Blog Post

   ..., M., Farouni, R., Lagler, S., Kalamakis, G., Lischetti, U., Jabaudon, D., & Platt, R. J. (2023). Transcriptional...

3. Common Injection Routes in Mice

   Type

   Blog Post

   ... for you — and the mice. While not an exhaustive list, these can include what’s being injected, the type...

4. Production of Virus in Insect Versus Mammalian Cells

   Type

   Blog Post

   ...Tompkins, G. J., & McCawley, P. (1977). The establishment of two cell lines from the insectspodoptera ...

5. Magnetic Control of Proteins: More than a Dream

   Type

   Blog Post

   ...range of topics. He embraces open science, self-publishing directly on his website (and often posting updates...

6. 3D Printing Meets CRISPR Cas9

   Type

   Blog Post

   ...could make a model of Cas9 based on the structure published by Martin Jinek’s group. We had already made an...

7. Cloning Mammalian Cells with the Agarose Method

   Type

   Blog Post

   ...protein, we have used Western blots, dot blots, ELISAs, and enzyme assays to select both over- and under-expressing...

8. Quick Guide to Working with Drosophila Part 1: Getting Started with Flies

   Type

   Blog Post

   ... stocks that are available to everyone. Flybase lists what stocks are available at Bloomington, but you...

9. Hot Plasmids and Viral Preps - May 2021

   Type

   Blog Post

   ...synthetic human scFV library and characterized them by ELISA, homogeneous time resolved fluorescence, and suspension...

10. Transferable Skills Guide: Managing a Team

    Type

    Blog Post

    ...  Equally as important is to be able to actively listen - this can be hard - but it is the best way to ...

11. Addgene's Cancer Collection Pages Connect the Research Community

    Type

    Blog Post

    ...gene of interest will direct the investigator to a list of all available Addgene plasmids he or she can ...

12. Plasmids 101: Optimizing Plasmid Yields

    Type

    Blog Post

    ...handy guide from OpenWetWare for a more extensive listing of common E. coli strains. Increase the volume ...

13. When is a Monomer not a Monomer? The Top Three Ways Your Favorite Fluorescent Protein Oligomerizes in Cells

    Type

    Blog Post

    ...dimeric FP could ruin your day (and experiment) are listed below. Solutions to avoid these all too common ...

14. Transgenic Organisms, Cas9 Gene Drives, and Appropriate Safeguards

    Type

    Blog Post

    ...negligible level. One major reason we chose to publish the concept and likely capabilities of RNA-guided...

15. Interview: Nicola Patron on Plant Synthetic Biology, MoClo, and More

    Type

    Blog Post

    ...purification; the whole cloning process is so simplistic once you have your parts. That was the motivation...

16. Tips for Using BLAST to Verify Plasmids

    Type

    Blog Post

    ...alignment tools available. Try these resources for lists of alternatives to BLAST: ExPASy - http://www.expasy.org...

17. Which Fluorescent Protein Should I Use?

    Type

    Blog Post

    ...pH changes (e.g. pHluorin, pHTomato). Keep this list handy as you plan your next experiment or to hand...

18. New Optimized Genome-wide CRISPRko, CRISPRi, and CRISPRa Libraries

    Type

    Blog Post

    ... selected and ranked based on the previously established sgRNA rules and  potential on- and off-target...

19. Plasmids 101: Choosing an Antibiotic Resistance Gene

    Type

    Blog Post

    ... toxic to dividing cells. The other antibiotics listed below affect continuous cellular processes (e.g...

20. INTEGRATE: Bacterial Genome Engineering Using CRISPR-Transposons

    Type

    Blog Post

    ...genome engineering in bacteria, alongside more established tools such as Cas9-recombineering, CRISPRa/i,...