We narrowed to 852 results for: Tat

...Dallas was the first to be infected in the United States while caring for a patient, despite wearing protective...

...Reverse hU6-F GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward T3...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...GAL1 AATATACCTCTATACTTTAACGTC S. cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG S. ...GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG 3' end ...Forward pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin Forward pBRforBam CTTGGAGCCACTATCGAC In pBR322 tet ...pBRforEco AATAGGCGTATCACGAGGC In pBR322, upstream of EcoRI site Forward pBRrevBam GGTGATGTCGGCGATATAGG In pBR322...

...importantly, what doesn’t. Reports receive a DOI for citation, crediting researchers when their data is used...

...background.       Are none of those backgrounds representative of your favorite technique? Our lab-themed ...

...university’s purchasing system. What’s the order status? My purchasing department faxed the PO a month ...

.... Thus, they engineered two CBE variants with mutations in the rat APOBEC1 that decreases the number of...

...efficiency in both immunofluorescence and immunoprecipitation applications, but none of the traditional...

...DNA strand. The lab then found gain-of-function mutations that allows it to be repurposed for double strand...

...potential PI in terms of mentoring style and expectations. Make sure you will enjoy being in that lab ...

...the Medical Intensive Care Unit, the Pulmonary Consultation Service, the Alpha-1 Center, and the Pulmonary...

...scientific topics, as well as archived seminar presentations. One of SITN's newest initiatives, DayCon was...

...actually being in the office. However, after my orientation on July 6th I was a little more certain that ...

...Single base editor that induces C-to-T and A-to-G mutations Nozomu Yachie’s lab recently developed a base ...

... been 50 years since the creation of the United States Environmental Protection Agency, which started ...

...living animals, to explore pathways that confer metastatic potential or the ability to survive in certain...

...relationships because networking has gotten a bad reputation (as in…”I just hate networking”). Scientists ...

...we head into Thanksgiving weekend in the United States, I look forward to gathering around a large table...

...E123T mutation; faster kinetics but reduced photocurrent amplitude 490 ChR/T159C T159C mutation; displays...improve these natural opsins by inducing point mutations to alter the absorption spectrum or adding trafficking... variants have been created via genetic point mutations, codon optimization, and chimeric fusion of domains...function as light-gated cation channels resulting in excitation (depolarization) of the neuron. Inhibitory (hyperpolarizing...complexity of these signaling networks and other limitations like bleaching. A more selective way to stimulate...injection of a small molecule is less invasive than implantation of fiber optics, making LMOs a versatile option...Chlamydomonas reinhardtii Name Description Peak excitation λ (nm) ChR2 Widely used light-gated cation channel...

...Annotation of genes in immune cells typically involves the creation of germline knockout mice, which ...

...Slayer 🗡️ (@chngin_the_wrld) November 8, 2017 Facilitating the search of phages for therapy Phage Directory...