Skip to main content

We narrowed to 852 results for: tat

Showing: 681 - 700 of 852 results
  1. A Scientist's Guide to Ebola

    Type
    Blog Post
    ...Dallas was the first to be infected in the United States while caring for a patient, despite wearing protective...
  2. Sequencing Primers

    Type
    Guide
    ...Reverse hU6-F GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward T3...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...GAL1 AATATACCTCTATACTTTAACGTC S. cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG S. ...GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG 3' end ...Forward pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin Forward pBRforBam CTTGGAGCCACTATCGAC In pBR322 tet ...pBRforEco AATAGGCGTATCACGAGGC In pBR322, upstream of EcoRI site Forward pBRrevBam GGTGATGTCGGCGATATAGG In pBR322...
  3. What's New in CRISPR - May 2019

    Type
    Blog Post
    .... Thus, they engineered two CBE variants with mutations in the rat APOBEC1 that decreases the number of...
  4. Optogenetics Guide

    Type
    Guide
    ...E123T mutation; faster kinetics but reduced photocurrent amplitude 490 ChR/T159C T159C mutation; displays...improve these natural opsins by inducing point mutations to alter the absorption spectrum or adding trafficking... variants have been created via genetic point mutations, codon optimization, and chimeric fusion of domains...function as light-gated cation channels resulting in excitation (depolarization) of the neuron. Inhibitory (hyperpolarizing...complexity of these signaling networks and other limitations like bleaching. A more selective way to stimulate...injection of a small molecule is less invasive than implantation of fiber optics, making LMOs a versatile option...Chlamydomonas reinhardtii Name Description Peak excitation λ (nm) ChR2 Widely used light-gated cation channel...
Showing: 681 - 700 of 852 results