We narrowed to 14 results for: tat

...include tat , as the 5’ LTR is used as a promoter on the transfer plasmid, and this requires Tat for activation...lentiviruses additionally require the regulatory genes tat and rev , along with virus-specific accessory genes...packaging genes gag and pol , and regulatory genes tat and rev ; separated into two plasmids in third generation...wild-type LTRs Packaging plasmid — contains gag , pol , tat , and rev Envelope plasmid — contains env All second-generation...system because transgene expression from the LTR is Tat-dependent. Figure 3: Second-generation lentiviral...viral titers due to the additional plasmid. Second, tat is not required in the third-generation system. Instead...RSV), eliminating the need for transactivation by Tat. Most third-generation transfer plasmids also contain...

...Reverse hU6-F GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward T3...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...GAL1 AATATACCTCTATACTTTAACGTC S. cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG S. ...GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG 3' end ...Forward pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin Forward pBRforBam CTTGGAGCCACTATCGAC In pBR322 tet ...pBRforEco AATAGGCGTATCACGAGGC In pBR322, upstream of EcoRI site Forward pBRrevBam GGTGATGTCGGCGATATAGG In pBR322...

...developed by mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...off-target mutations in DNA, RNA, or both, and are recommended in contexts where such mutations would be...target DNA. Once the Cas9-gRNA complex binds a putative DNA target, the seed sequence (8–10 bases at the... and a gRNA will result in a diverse array of mutations (see: Validate genetic modification ). In most...amino acid deletions, insertions, or frameshift mutations leading to premature stop codons within the open...targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the strength...Catalytically inactive “dead” Cas9 (dCas9) contains mutations in both nuclease domains, D10A and H840A, resulting...

...improve these natural opsins by inducing point mutations to alter the absorption spectrum or adding trafficking...physiological pH and traffics well to the membrane. Excitatory (Depolarizing) ChR Variants The optogenetic toolbox... variants have been created via genetic point mutations, codon optimization, and chimeric fusion of domains... as light-gated, cation channels resulting in excitation (depolarization) of the neuron. Feature enhancements...photocurrent compared to CrChR2 450 ChETA E123T mutation; creates faster kinetics but reduces photocurrent...photocurrent amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/SSFO Step function...function Opsins and Stabilized Step Function Opsins. Mutations at C128 and D156 of CrChR delay the closing of...

...Furthermore, in cells containing two mutated alleles, each mutated allele may be different owing to the...many different types of edits, including point mutations, base changes, and large insertions or deletions...increases specificity but is less efficient Each putative knockout allele must be experimentally verified...) Generate specific genomic edits, like point mutations or small tag insertions, by copying from a DNA...Generate targeted insertions, deletions, and point mutations using a prime editing guide RNA (pegRNA) Prime... alternative splicing, and an early frameshift mutation is more likely to result in a non-functional protein...as there are for viral vectors — the only size limitation is what you can efficiently transfect. However...

...protein complexes. Includes: Immunoprecipitation (IP) Chromatin immunoprecipitation (ChIP) Visualization - ...Capture methods such as immunoprecipitation (IP) and chromatin immunoprecipitation (ChIP) allow you to isolate...which emit a specific wavelength of light after excitation by light of a specific wavelength. While more...interactions in a specific timeframe or context. Immunoprecipitation (IP) IP uses immobilized antibodies to isolate... on the same general strategy. Figure 5: Immunoprecipitation using bead-based antibody capture to isolate...isolating protein from serums. Chromatin immunoprecipitation (ChIP) This variation of IP uses antibodies...for individual assays. Clear cell debris by sedimentation. Proceed with IP using a primary antibody for...

...strand. The TATA box is a DNA sequence (TATAAA) within the core promoter region. The TATA-binding protein...transcription start site (TSS) (Figure 2). The Pribnow box (TATAAT) is located at the -10 position and is essential...codon and contains the RNA polymerase binding site, TATA box, and TSS. RNA polymerase will stably bind to...protein binds the TATA box and helps in the subsequent binding of the RNA polymerase. General transcription...that package DNA into nucleosomes) also bind the TATA box. Histone binding prevents the initiation of ...

... tools. Studies of GPCRs led to development of mutated receptors that while unresponsive to endogenous...experimental setup) were not possible. To overcome this limitation, the inhibitory KORD DREADD was developed to ...PSEMs). PSAM domains were first named for the mutations that allowed them to respond to their cognate ...anti-smoking drug varenicline. This PSAM carries mutations at L131G, Q139L, and Y217F and is termed PSAM4...Krashes, M. J., … Roth, B. L. (2015). A New DREADD Facilitates the Multiplexed Chemogenetic Interrogation of...

... or under the line are in forward or reverse orientation, respectively. Created with BioRender.com. Adenoviruses...have matching left and right homology arms which facilitate homologous recombination of the transgene into...candidates for multiple infectious diseases and prostate cancer. Cancer Treatment Recombinant adenoviral... the National Academy of Sciences of the United States of America, 95 (5), 2509–2514. https://doi.org/... cells. Replication-competent adenovirus (RCA) Mutated adenoviral vector that has the ability to replicate...

... create and test capsid libraries with random mutations or insertions in the Cap region. Several methods...vectors . Read our blog post on overcoming AAV size limitation for CRISPR delivery for more information. Split...with trans-splicing or overlapping vectors: a quantitative comparison . Molecular Therapy, 4 (4), 383–391...often altering gene activity. Latent infection A state where a pathogen is present in an organism but not...material into cells. Replication-competent rAAV Mutated rAAV vector that has the ability to replicate and...

... vectors specific for tobacco ( N. tabacum ) or potato ( S. tuberosum ). Joint Modular Cloning (JMC) Toolkit... MoBiFC - Modular Bimolecular Fluorescence Complementation Toolkit Plant Expression Benjamin Field 50 ...plasmids for assembling bimolecular fluorescence complementation experiments to analyze protein-protein interactions...Lahaye Plasmids to generate gene knockout and complementation constructs for use in Ralstonia solanacearum...

...elements often determines the type of plasmid and dictates how it might be used in the lab. Regardless of... Addgene Resource(s) Cloning Plasmids Used to facilitate the cloning of DNA fragments. Cloning vectors... gene function as well as identify changes or mutations that may cause certain diseases. Sequencing DNA...

... plasmid that has the same sites in the same orientation within its MCS. Due to their short length, it...assembly of multiple fragments of DNA in the chosen orientation at a time, and without the need for any unwanted...

...harnessed for stable delivery of various genes, mutations, or treatments into cells, and has been widely...possible development of cancer. Pseudotyping Tropism dictates which types of host cells the gamma-retroviral...