We narrowed to 731 results for: Sis;

...markers, such as the puromycin resistance gene, conferring antibiotic resistance to infected host cells. When...Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning...information encoded by that genome. Antibiotic resistance is not the only type of selectable marker. Fluorescent...replication-competent gamma-retroviral vectors The potential for oncogenesis The potential for generation of replication-competent... of the full-length virus. The potential for oncogenesis is largely based on whether or not the specific... for oncogenes should be made on a case-by-case basis. Retroviruses carry a slightly elevated risk of ...polypurine tract; recognition site for proviral DNA synthesis. Increases transduction efficiency and transgene...

...of neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse...puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse...Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene Reverse AUG1 Forward CAATTTACATCTTTATTTATTAACG...GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG...Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine...

... the potential for insertional mutagenesis and the risk of oncogenesis. However, random integration events...Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning...used generation for research purposes. The system consists of two plasmids that eventually recombine to form... signals of infection or damage. Insertional mutagenesis Random insertion of DNA elements into the genome...to the destruction of cancer cells, generally by lysis. pAdEasy-1 Adenoviral backbone plasmid that lacks...

... chimera 470 ChIEF, ChEF, ChD Engineered by chimeragenesis of ChR1 and ChR2 450-470 C1V1 ChR1-VChR1 chimera...improve upon previous tools through directed mutagenesis. Find optical switches in Addgene's Optogenetics...Blue-light–mediated induction of protein interactions based on Arabidopsis thaliana cryptochrome 2 and CIB1 450 LARIAT Inhibits...OPTOSTIM PHR domain2 of cryptochrome 2 (Cry2) from Arabidopsis thaliana is fused to truncated forms of cytosolic...optogenetic tools derived from direct comparative analysis of microbial opsins. Nat Methods, 9 (2), 159–172...

...CRISPR libraries include: resistance to the anti-cancer drug vemurafenib , resistance to Clostridium septicum...phenotype, and allow you to design additional hypothesis-directed experiments. As you might have guessed...septicum alpha-toxin , and resistance to to the nucleotide analog 6-thioguanine . Next-generation sequencing...

...position, simply titled the -35 element, typically consists of the sequence TTGACA, and this element controls...transcription. Bacterial cells contain sigma factors that assist the RNA polymerase in binding to the promoter region...have also been discovered in eukaryotes. Operons consist of a promoter (which is recognized by the RNA polymerase... structure. Ribosomes are the site of protein syntehsis where mRNA is translated into a protein. RNA polymerase...

... Minibodies are engineered antibody fragments consisting of two scFvs bound to a CH3 domain. Fab fragments...specific proteins or protein complexes for downstream analysis. They are powerful tools for understanding protein...complex and can be sequenced and amplified for analysis. Overview of application Process tissue or cell...crosslink, isolate DNA, and perform downstream analysis. Special considerations One type of ChIP assay...

...sequencing, vectors, and restriction enzymes to assist with your molecular biology research. Topics include...plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating...

...gene-editing tools, and more. The MoClo system consists of three sets of cloning vectors (Level 0, 1, ...specifically designed for generating zebrafish transgenesis constructs, but is also suitable for creating...

...the presence of a selectable marker (antibiotic resistance or fluorophore) are also relevant. Delivery Using...Hanna, R. E., & Doench, J. G. (2020). Design and analysis of CRISPR–Cas experiments. Nature Biotechnology...

...manipulation for ameliorating Huntington's disease pathogenesis. iScience, 28 (3), 112022. https://doi.org/10.1016...