Skip to main content
Addgene

We narrowed to 14 results for: Sis;

Showing: 1 - 14 of 14 results
  1. Molecular Biology Reference

    Type
    Guide
    ...populations, an antibiotic resistance gene (i.e., a gene whose product confers resistance to ampicillin) is included...providing a benefit to the host, such as antibiotic resistance. This benefit can be context-dependent, and thus...of restriction enzymes, DNA ligase, and gel electrophoresis allowed for the ability to move specific fragments...includes a DNA replication origin, an antibiotic-resistance gene, and a region in which exogenous DNA fragments... origin of replication ( ori ), an antibiotic-resistance gene, and at least one unique restriction enzyme...plasmids are convenient and easy to use. Antibiotic Resistance Gene Allows for selection of plasmid-containing... important to distinguish that the antibiotic resistance gene is under the control of a bacterial promoter...
  2. CRISPR Guide

    Type
    Guide
    ...including resistances to chemotherapy drugs and toxins, cell viability, and tumor metastasis. One of the...editing systems include targeted AID-mediated mutagenesis (TAM) and CRISPR-X , in which Cas9 is fused to...nsertion of T ransposable E lements by G uide R NA- A ssisted T argeting), developed by Samuel H. Sternberg’s...large scale edits. PASSIGE ( P rime- E diting- A ssisted S ite- S pecific I ntegrase G ene E diting), developed...desired phenotype. The ease of gRNA design and synthesis, as well as the ability to target almost any genomic...simplest dCas9-based activators and repressors consist of dCas9 fused directly to a single transcriptional...than other activators/repressors due to their persistence and heritability. Not all modifications are stable...
  3. Lentiviral Vector Guide

    Type
    Guide
    ...markers, such as the puromycin resistance gene, conferring antibiotic resistance to infected host cells. When...Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning...led to the development of multiple genome-wide analysis pipelines to assess viral integration (see Kim...information encoded by that genome. Antibiotic resistance is not the only type of selectable marker. Fluorescent...replication-competent lentiviral vectors The potential for oncogenesis The potential for generation of replication-competent... of the full-length virus. The potential for oncogenesis is largely based on whether or not the specific... for oncogenes should be made on a case-by-case basis. As with most experiments, infection risks occur...
  4. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...material inside. The AAV genome is ~4.7 kb long and consists of two open reading frames, Rep and Cap, flanked...Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning...episomes can develop chromatin-like organization and persist in non-dividing cells for a period of years without... eliminates the requirement for host cell DNA synthesis but further limits the packaging capacity of rAAV...immune response, and the low risk of insertional mutagenesis. Several AAV-based gene therapies have been approved...treatment of other major diseases such as cystic fibrosis and cancer. Neuronal Tracing Recombinant AAV vectors...chromosome, which reduces the risk of insertional mutagenesis. However, random integration events can occur...
  5. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...markers, such as the puromycin resistance gene, conferring antibiotic resistance to infected host cells. When...Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning...information encoded by that genome. Antibiotic resistance is not the only type of selectable marker. Fluorescent...replication-competent gamma-retroviral vectors The potential for oncogenesis The potential for generation of replication-competent... of the full-length virus. The potential for oncogenesis is largely based on whether or not the specific... for oncogenes should be made on a case-by-case basis. Retroviruses carry a slightly elevated risk of ...polypurine tract; recognition site for proviral DNA synthesis. Increases transduction efficiency and transgene...
  6. Sequencing Primers

    Type
    Guide
    ...neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene, ...Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward CAATTTACATCTTTATTTATTAACG...GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG...Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA...
  7. Adenovirus Guide

    Type
    Guide
    ... the potential for insertional mutagenesis and the risk of oncogenesis. However, random integration events...Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning...used generation for research purposes. The system consists of two plasmids that eventually recombine to form... signals of infection or damage. Insertional mutagenesis Random insertion of DNA elements into the genome...to the destruction of cancer cells, generally by lysis. pAdEasy-1 Adenoviral backbone plasmid that lacks...
  8. Promoters

    Type
    Guide
    ...equivalent called the Pribnow box which usually consists of the six nucleotides, TATAAT. Proximal Promoter...position, simply titled the -35 element, typically consists of the sequence TTGACA and this element controls...transcription. Bacterial cells contain sigma factors which assist the RNA polymerase in binding to the promoter region...have also been discovered in eukaryotes. Operons consist of a promoter, which is recognized by the RNA polymerase... structure. Ribosomes are the site of protein syntehsis where mRNA is translated into a protein. RNA polymerase...
  9. Optogenetics Guide

    Type
    Guide
    ... chimera 470 ChIEF, ChEF, ChD Engineered by chimeragenesis of ChR1 and ChR2 450-470 C1V1 ChR1-VChR1 chimera...improve upon previous tools through directed mutagenesis - use Addgene's Optical Switch Plasmid Table ...Blue-light–mediated induction of protein interactions based on Arabidopsis thaliana cryptochrome 2 and CIB1 450 LARIAT Inhibits...OPTOSTIM PHR domain2 of cryptochrome 2 (Cry2) from Arabidopsis thaliana is fused to truncated forms of cytosolic...optogenetic tools derived from direct comparative analysis of microbial opsins. Nat Methods. 9(2):159-72....
  10. Guide to Using Pooled Libraries

    Type
    Guide
    ...CRISPR libraries include: resistance to the anti-cancer drug vemurafenib , resistance to Clostridium septicum...phenotype, and allow you to design additional hypothesis-directed experiments. As you might have guessed...septicum alpha-toxin , and resistance to to the nucleotide analog 6-thioguanine . Next-generation sequencing...
  11. Antibody Guide

    Type
    Guide
    ... Minibodies are engineered antibody fragments consisting of two scFvs bound to a CH3 domain. Fab fragments...specific proteins or protein complexes for downstream analysis. They are powerful tools for understanding protein...complex and can be sequenced and amplified for analysis. Overview of application Process tissue or cell...crosslink, isolate DNA, and perform downstream analysis. Special considerations One type of ChIP assay...
  12. Educational Resources

    Type
    Guide
    ...sequencing, vectors, and restriction enzymes to assist with your molecular biology research. Topics include...plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating...
  13. Plan Your Experiment

    Type
    Guide
    ...identify DNA fragments. PCR amplification and gel electrophoresis (for HDR or NHEJ): For large deletions or insertions...
  14. Chemogenetics Guide

    Type
    Guide
    ...Manipulation for Ameliorating Huntington's Disease Pathogenesis. iScience , in press. Magnus CJ, Lee PH, Atasoy...
Showing: 1 - 14 of 14 results