Skip to main content

We narrowed to 15 results for: Sis;

Showing: 1 - 15 of 15 results
  1. Molecular Biology Reference

    Type
    Guide
    ...antibiotic resistance and additional antibiotics, see our blog post on antibiotic resistance genes . Below...provide a benefit to the host, such as antibiotic resistance, and can be passed from one bacterium to another... restriction enzymes, DNA ligases, and gel electrophoresis enabled the movement of specific fragments ... origin of replication ( ori ), an antibiotic resistance gene, and at least one unique restriction enzyme...be copied (amplified) by bacteria. Antibiotic Resistance Gene Allows for selection of plasmid-containing...is typically in the form of another antibiotic resistance gene under the control of a non-bacterial promoter...very simple, often containing only a bacterial resistance gene, origin of replication, and an MCS. They...
  2. CRISPR Guide

    Type
    Guide
    ...including resistances to chemotherapy drugs and toxins, cell viability, and tumor metastasis. One of the...editing systems include targeted AID-mediated mutagenesis (TAM) and CRISPR-X , in which Cas9 is fused to...nsertion of T ransposable E lements by G uide R NA- A ssisted T argeting), developed by Samuel H. Sternberg’s...large scale edits. PASSIGE ( P rime- E diting- A ssisted S ite- S pecific I ntegrase G ene E diting), developed...desired phenotype. The ease of gRNA design and synthesis, as well as the ability to target almost any genomic...simplest dCas9-based activators and repressors consist of dCas9 fused directly to a single transcriptional...than other activators/repressors due to their persistence and heritability. Not all modifications are stable...
  3. Guide to Using Pooled Libraries

    Type
    Guide
    ...loss-of-function screens, in vivo mutagenesis, pathway mapping, and drug resistance studies. Advantages Broad ...that contribute to a phenotype. Pooled libraries consist of a single mixture of many different plasmids....phenotype, and allow you to design additional hypothesis-directed experiments. Barcoding libraries contain...transcription factors), or observing the effects of mutagenesis of a single gene. As you might have guessed from...in a phenotype. They are also useful for drug resistance screens and noncoding RNA studies. Each library...particular target gene) in an shRNA screen should show consistent results from the multiple shRNAs that target ...feel free to contact us at [email protected] for assistance. For some libraries, plasmid DNA can be delivered...
  4. Lentiviral Vector Guide

    Type
    Guide
    ...markers, such as the puromycin resistance gene, conferring antibiotic resistance to infected host cells. When...Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning...led to the development of multiple genome-wide analysis pipelines to assess viral integration (see Kim...information encoded by that genome. Antibiotic resistance is not the only type of selectable marker. Fluorescent...replication-competent lentiviral vectors The potential for oncogenesis The potential for generation of replication-competent... of the full-length virus. The potential for oncogenesis is largely based on whether or not the specific... for oncogenes should be made on a case-by-case basis. As with most experiments, infection risks occur...
  5. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...material inside. The AAV genome is ~4.7 kb long and consists of two open reading frames, Rep and Cap, flanked...Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning...episomes can develop chromatin-like organization and persist in non-dividing cells for a period of years without... eliminates the requirement for host cell DNA synthesis but further limits the packaging capacity of rAAV...immune response, and the low risk of insertional mutagenesis. Several AAV-based gene therapies have been approved...treatment of other major diseases such as cystic fibrosis and cancer. Neuronal Tracing Recombinant AAV vectors...chromosome, which reduces the risk of insertional mutagenesis. However, random integration events can occur...
  6. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...markers, such as the puromycin resistance gene, conferring antibiotic resistance to infected host cells. When...Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning...information encoded by that genome. Antibiotic resistance is not the only type of selectable marker. Fluorescent...replication-competent gamma-retroviral vectors The potential for oncogenesis The potential for generation of replication-competent... of the full-length virus. The potential for oncogenesis is largely based on whether or not the specific... for oncogenes should be made on a case-by-case basis. Retroviruses carry a slightly elevated risk of ...polypurine tract; recognition site for proviral DNA synthesis. Increases transduction efficiency and transgene...
  7. Sequencing Primers

    Type
    Guide
    ...of neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse...puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse...Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene Reverse AUG1 Forward CAATTTACATCTTTATTTATTAACG...GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG...Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine...
  8. Adenovirus Guide

    Type
    Guide
    ... the potential for insertional mutagenesis and the risk of oncogenesis. However, random integration events...Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning...used generation for research purposes. The system consists of two plasmids that eventually recombine to form... signals of infection or damage. Insertional mutagenesis Random insertion of DNA elements into the genome...to the destruction of cancer cells, generally by lysis. pAdEasy-1 Adenoviral backbone plasmid that lacks...
  9. Promoters

    Type
    Guide
    ...position, simply titled the -35 element, typically consists of the sequence TTGACA, and this element controls...transcription. Bacterial cells contain sigma factors that assist the RNA polymerase in binding to the promoter region...have also been discovered in eukaryotes. Operons consist of a promoter (which is recognized by the RNA polymerase... structure. Ribosomes are the site of protein syntehsis where mRNA is translated into a protein. RNA polymerase...
  10. Optogenetics Guide

    Type
    Guide
    ...particular GPCR is to engineer a chimeric protein consisting of an opsin and the GPCR of interest (referred...luminescent opsins, are opto-chemogenetic tools consisting of a light-emitting luciferase fused to a light-sensing...previous tools through engineering, design, and mutagenesis. Glossary of Common Optical Switches UV Receptors...optogenetic tools derived from direct comparative analysis of microbial opsins. Nat Methods, 9 (2), 159–172...
  11. Antibody Guide

    Type
    Guide
    ... Minibodies are engineered antibody fragments consisting of two scFvs bound to a CH3 domain. Fab fragments...specific proteins or protein complexes for downstream analysis. They are powerful tools for understanding protein...complex and can be sequenced and amplified for analysis. Overview of application Process tissue or cell...crosslink, isolate DNA, and perform downstream analysis. Special considerations One type of ChIP assay...
  12. Educational Resources

    Type
    Guide
    ...sequencing, vectors, and restriction enzymes to assist with your molecular biology research. Topics include...plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating...
  13. Modular Cloning Guide

    Type
    Guide
    ...gene-editing tools, and more. The MoClo system consists of three sets of cloning vectors (Level 0, 1, ...specifically designed for generating zebrafish transgenesis constructs, but is also suitable for creating...
  14. Plan Your Experiment

    Type
    Guide
    ...the presence of a selectable marker (antibiotic resistance or fluorophore) are also relevant. Delivery Using...Hanna, R. E., & Doench, J. G. (2020). Design and analysis of CRISPR–Cas experiments. Nature Biotechnology...
  15. Chemogenetics Guide

    Type
    Guide
    ...manipulation for ameliorating Huntington's disease pathogenesis. iScience, 28 (3), 112022. https://doi.org/10.1016...
Showing: 1 - 15 of 15 results