We narrowed to 1,146 results for: Gene
-
TypeCollection...accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application...cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple, see article 69537 activate S. pyogenes 26352799...cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut S. pyogenes 23287722... cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...cut S. pyogenes 25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG 52226 cut S. pyogenes 25352017... 52225 cut S. pyogenes 25352017 Zaratiegui Alk and Eml M. musculus 64071 cut S. pyogenes 25337876 Ventura...
-
Brain Initiative Collection
TypeCollection...associated with Addgene materials. Plasmids ID Plasmid Description PI Viral Preps Addgene distributes ready-to-use...these antibodies are available at Addgene. AAV Viral Service . Addgene provides a viral service to help...the revolutionary dynamic picture of the brain generated through this effort will provide novel ways to...enables single cell, single millisecond resolution optogenetics. Human Synapsin (hSynapsin) promoter Edward ...enables single cell, single millisecond resolution optogenetics. Cre-dependent virus Edward Boyden 108422-AAV5...Hillel Adesnik 111066-AAV1 pAAV-hSyn-dLight1.1 To generate Adeno-Associated viruses for expression of dLight1.1...promoter Lin Tian 111067-AAV1 pAAV-CAG-dLight1.1 To generate Adeno-Associated viruses for expression of dLight1.1... -
Retrograde AAV viral preps
TypeCollection...helper plasmid (Addgene #81070) . This serotype permits robust retrograde access and transgene delivery to...Cre-dependent Optogenetics Deisseroth 26973 pAAV-hSyn-hChR2(H134R)-EYFP Syn Activator Optogenetics Deisseroth...Activator Optogenetics Svoboda 26975 pAAV-CaMKIIa-hChR2(H134R)-mCherry CamKII Activator Optogenetics Deisseroth...Flp-dependent Optogenetics Deisseroth 58880 pAAV-Syn-ChR2(H134R)-GFP Syn Activator Optogenetics Boyden 59170...Activator Optogenetics Boyden 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 mDIx Activator Optogenetics Fishell...Cre-dependent Optogenetics Boyden 99039 pAAV-CamKII-ArchT-GFP (PV2527) CamKII Inhibitor Optogenetics Boyden ...Cre-dependent Optogenetics Yizhar 125712 pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE CamKII Inhibitor Optogenetics Yizhar... -
Antibody Production
TypeCollection...distributed by Addgene have been produced in-house by Addgene scientists. They are generated using standard...or by contacting help@addgene.org . Some of the antibodies distributed by Addgene were developed by the...Overview of Addgene's antibody production methods and quality control processes for purified recombinant...optimized for each specific antibody in order to generate high quality preparations. Following production...titered and undergo stringent quality control by Addgene or a trusted quality control partner before distribution... preparations developed at IPI may differ from Addgene antibodies in “Production & Usage” and “Delivery...using ImageJ software and a standard curve is generated. The final antibody concentration is calculated... -
All Antibodies
TypeCollection...Browse Addgene's collection of recombinant monoclonal antibodies....Antibodies Addgene distributes ready-to-use recombinant antibodies. These monoclonal antibodies undergo application-specific...application-specific validation and quality control by Addgene as well as by our trusted partner labs. On this...antibodies currently available from our catalog. Addgene values transparency and accessibility in research...reactivity. Reactivity is based on validation data from Addgene or trusted partner labs or is predicted based on... on sequence homology with the antigen. Addgene supplies a list of recommended applications based on our...immunohistochemistry, and immunocytochemistry. Addgene will continue to work with both depositing and ... -
Viral Prep Service for Plasmids and Pooled Libraries
TypeCollection...vectors, and general biosafety guidelines. Addgene Blog: Viral Vector Posts Content from Addgene and scientists...production at Addgene, ordering information, and more. Additional Viral Vector Resources Addgene's Data Hub...Overview of Addgene's viral preparation service for plasmids and pooled libraries. Viral preparation ... Viral Vector Packaging Service Addgene produces high-quality viral vector preps from select...is a common step after requesting plasmids from Addgene, and by providing this service, we can save you... to do when you receive your viral vector from Addgene, with details about storage. Biosafety Guide Documentation... the Penn Vector Core have been transferred to Addgene for distribution. Look up the IDs of particular... -
Plasmid Collections
TypeCollection... Addgene Homepage Plasmid Collections Addgene Plasmid Collections...Luminescence Fluorescent Proteins Luciferase Optogenetics Chemogenetics Viral Plasmids Lentivirus Adeno-associated...Browse Addgene’s curated collections of plasmids, kits, and pooled libraries. Find tools for CRISPR, ... proteins, optogenetics, biosensors, and more. Addgene...Collections Addgene's repository contains 162,160 plasmids . We've gathered our curated plasmid resources...Collection Bacterial Expression Systems Empty Backbones Genetic Code Expansion Immunology Mammalian RNAi Microbiology... Neuroendocrine Tumor Research Foundation Neurodegeneration Research Collection Rett Syndrome Plasmid ... -
DNA Service - Cloning Grade DNA
TypeCollection...assistance at help@addgene.org . Don’t See What You’re Looking For? At this time, Addgene has made a limited...Grade DNA Service Details Plasmids Available FAQ Addgene is offering Cloning Grade DNA (cgDNA) for over ...start cloning upon arrival of their plasmid from Addgene – reducing the time to experiments by removing ...Standard Quality Control Plasmid verified by next generation sequencing Plasmids Available as Cloning Grade...the plasmid sequence has been validated by next generation sequencing. The DNA concentration and 260/280...resources or scientific support? Please see our Addgene Protocols for resources you may find helpful. Our... Please note that this does not guarantee that Addgene will make cloning grade DNA preps of this plasmid... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...Addgene's collection of plasmids for viral pseudotyping with SARS-CoV-2 spike protein....the live virus. Alternatively, it is possible to generate pseudovirus, where the structural and functional...protein and you will find examples of each in Addgene's collection: HIV-based lentiviral particles Murine...particles Vesicular stomatitis virus particles See Addgene's Viral Plasmids and Resources page for more information...lists expression plasmids that are suitable for generating pseudotyped virus for SARS-CoV-2 and other coronaviruses...Pseudotyped virus protocol for coronaviruses (184 KB) Addgene Blog Posts Viral Vectors 101: Pseudotyping Antibody...Pseudoviruses Expressing SARS-CoV-2 Spike Protein Variants Addgene COVID-19 Resources and Collections COVID-19 and... -
Fluorescent Protein Guide
TypeCollection...intracellular processes with genetically encoded fluorescent biosensors. Optogenetics Plasmids | Guide Use light...actuators or sensors. Chemogenetics Plasmids | Guide Use small molecules to activate genetically engineered cellular... to find the plasmids that are available from Addgene's depositing scientists. Special...Protein Kits Blog: When is a Monomer not a Monomer? Addgene's plasmid repository contains a variety of fluorescent... to find the plasmids that are available from Addgene's depositing scientists. Browse Fluorescent Protein... -
Antibodies
TypeCollection...Overview of Addgene's ready-to-use monoclonal recombinant antibody collection. These affinity reagents... Antibodies Addgene distributes ready-to-use recombinant antibodies...experimental data for recommended applications. Addgene values transparency and accessibility in research...All Antibodies Ready to use antibodies? Browse Addgene’s collection of antibodies developed and validated...Production Interested in our production process? At Addgene, we provide transparency in our production process...antibody. Antibody Blog Posts Recipient Instructions Addgene Help Center Antibody Protocols Looking for Antibody... -
NETRF
TypeCollection...Addgene Depositors that have received funding from the Neuroendocrine Tumor Research Foundation...around the world. The NETRF is grateful for the generous support of philanthropic individuals and foundations...Ramesh Shivdasani Dana-Farber Cancer Institute Epigenetic Regulators of Intestinal Endocrine Cells and ...Carcinoid Tumors Qiao Zhou Harvard University Epigenetic Regulators of Intestinal Endocrine Cells and ...Bernstein Broad Institute Identifying Altered Epigenetic States and Drivers in Intestinal Carcinoid and... -
New England Biolabs Cell-Imaging Plasmid Collection
TypeCollection...England Biolabs has deposited plasmids at Addgene to generate SNAP, CLIP, ACP or MCP tagged plasmids for...associated with this technology are available at Addgene for distribution to the research community. Key...synthases needed for use of these tags. Plasmids Addgene ID Plasmid Substrate Feature 101137 pSNAP-tag (...and the ACP and SFP Synthases. Users may still generate their own fluorescent or non-fluorescent CoA substrates... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection... For more details, visit the Allen Institute's Genetic Tools Atlas (Link opens in a new window) . Figure... in adult mice. Adapted from Allen Institute's Genetic Tools Atlas (Link opens in a new window) . Allen...Striatum Pallidum Hypothalamus Cerebellum Whole brain Addgene ID Plasmid Allen Institute ID Enhancer ID FP/Recombinase...of enhancer AAVs and transgenic mouse lines for genetic access to cortical cell types. bioRxiv [Preprint... -
Fluorescent Protein Guide: In Vivo Imaging
TypeCollection...Empty Backbones FRET Subcellular localization Optogenetics Background In vivo imaging is a powerful tool...interactions in deep-tissue organs and whole mammals. Genetically encoded fluorescent probes are suitable for stable...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!... -
Trimmer Lab NeuroMab Collection
TypeCollection...deposited with Addgene for distribution to the research community. Protocols for the generation R-mAbs plasmids...researchers will be able to easily and inexpensively generate R-mAbs by transiently transfecting the plasmids...produce R-mAbs from transfected mammalian cells. Addgene ID Plasmid Target Target Species Host Species Isotype...musculus (mouse)/R. norvegicus (rat) rat IgG2a Addgene distributes ready-to-use recombinant antibodies...application-specific validation and quality control by Addgene as well as by our trusted partner labs. Learn More...produce scFvs from transfected mammalian cells. Addgene ID Plasmid Hybridoma Target Target Species Host...produce nanobodies from transfected bacterial cells. Addgene ID Plasmid Hybridoma Target Target Species Host... -
Institute for Protein Innovation
TypeCollection...secreted proteins from a collaboration between Addgene and IPI....sorting process. This combination allows IPI to generate antibodies to highly conserved proteins and other...Other Markers Antibody Collection page to browse Addgene’s full catalog of antibodies that target epitope... -
Tags and Other Markers
TypeCollection...application-specific validation and quality control by Addgene as well as by our trusted partner labs. To learn...our Suggest an Antibody form, or e-mail help@addgene.org to help us improve our resources!... -
Neuroscience
TypeCollection...application-specific validation and quality control by Addgene as well as by our trusted partner labs. To learn...our Suggest an Antibody form, or e-mail help@addgene.org to help us improve our resources! Acknowledgments... -
Impact of Genomic Variation on Function (IGVF) Consortium Collection
TypeCollection...Browse plasmid tools generated by IGVF Consortium investigators to examine how genomic variation affects...phenotype and shares their plasmid tools through Addgene. ID Plasmid Description Vector Type PI Publication...