Skip to main content

We narrowed to 527 results for: HA tag

Showing: 91 - 120 of 527 results
  1. AAV Viral Preps

    Type
    Collection
    ...range of experiments, both in vitro and in vivo. It has low immunogenicity, is easy to use, and can be safely...Biosensors Calcium Sensors, Glutamate Sensors, Voltage Reporters Controls Fluorescent Proteins, Spagehetti...
  2. Even more elegant: Single injection CRISPR/Cas9 in C. elegans

    Type
    Blog Post
    ...time. Creating a modular, selection-based gene tagging approach Multiple features of C. elegans have made... between a fluorescent protein (FP) and a 3xFLAG tag (see construct schematic below.) After self-excision...intron, and only the fluorescent protein and 3xFLAG-tag sequences are inserted into the genome. Figure...template plasmid to create fluorescent and 3xFLAG-tag fusion proteins. The repair template and Cas9-sgRNA.... (2015) illustrating the steps to fluorescently tag a C. elegans protein. The his-72 locus is shown as...little hands-on labor and could facilitate the tagging of every protein in the C. elegans genome. Although... gene tagging...
  3. Hot Plasmids - March 2019 - Anti-CRISPR, 2in1 Cloning, Fluorescent Voltage Indicators, and Photoswitchable Proteins

    Type
    Blog Post
    ...binary 2in1 vectors with all possible combinations of tag orientation (NN, NC, CN, and CC). The 4 kits also... Archon1 is  bright, exhibits good localization, has high signal:noise ratio, high sensitivity, responds...levels are more evenly controlled. The Grefen Lab has utilized the 2in1 cloning system to generate a series...fluorescent voltage indicator Archon Article contributed by Shreya Vedantam  Listen to the voltage indicator...turned to genetically encoded voltage indicators. To expand the voltage indicator toolbox, Ed Boyden’s...fluorescent voltage indicator. Archon1 can embed itself into the cell membrane where cell voltage can then...vectors (pUC57-L1L4 and pUC57-L3L2) that offer the advantage of using restriction digest cloning to introduce...
  4. Better Dyeing Through Chemistry & Small Molecule Fluorophores

    Type
    Blog Post
    ...concept include: Self-labeling tags (e.g., SNAP-tag, HaloTag, TMP-tag) – These widely used systems consist...strategies have two parts: (1) a genetically encoded “tag” expressed as a fusion with your favorite protein...fluorophore-contianing “ligand” that binds to the tag. Like most good ideas in biological imaging, the ...genetically encoded tetracysteine (Cys4) peptide tag could be used to label proteins in cells (Figure ...consist of a genetically encoded enzyme variant tag that reacts specifically and irreversibly with a small... attachment of a fluorophore ligand to a peptide tag (Figure 1c). Click chemistry (e.g., transcyclooctene–tetrazine...paclitaxel. Unlike other systems, no genetically encoded tag is required as the small-molecule binding motif targets...
  5. Antibodies 101: Single Chain Fragment Variables (scFvs)

    Type
    Blog Post
    ...in living cells. The HA frankenbody is an HA tag detection probe. It contains an HA-binding scFv that’s... The SunTag system uses an scFv to amplify the fluorescence intensity of a tagged protein. SunTag has ...about the SunTag system which uses an scFv to amplify the fluorescence intensity of a tagged protein. ...two components: 1) a protein of interest that’s tagged with 10-24 copies of the short epitope GCN4, also...often genetically fused to other proteins, which has led to their application for basic and translational...s fused to a fluorescent protein such as GFP. The HA frankenbody works just like an antibody-based probe...of cytotoxic granules from the T cell. When a CAR has an scFv that binds cancer-related antigens, binding...
  6. Synthesized by Ginkgo Bioworks, Shared by Addgene: SARS-CoV-2 Plasmids for Many Expression Systems

    Type
    Blog Post
    ..., codon optimized, untagged, cleavage sites (thrombin and TEV), and C-terminal tags (StrepII, 3xFLAG, ...expression constructs contain protein coding genes, tags, truncations, and codon optimizations similar to... downstream experiments and offer flexibility in tag, cleavage, codon usage, and expression system. Mammalian...expression vector are also available. These contain no tags and are intended to be used in the production of...slower, more traditional, QC process. While this has worked well for the early sets of SARS-CoV-2 materials...certain processes in both core operations. As it has been in much of the world, we have found ourselves...Resources Page! References Fukushi S, Watanabe R, Taguchi F (2008) Pseudotyped Vesicular Stomatitis Virus...
  7. What's New in CRISPR - December 2019

    Type
    Blog Post
    ...Burkholderia Base editors CRISPR toolkit for epitope tagging Lentiviral capsid-based Cas9/gRNA ribonucleoprotein...Target-ACE   CRISPR/Cas9-based toolkit for epitope tagging in neurons Harold MacGillavry’s lab developed a... for targeted genomic integration of fluorescent tags in neurons. Their toolkit named ORANGE (Open Resource...mediates targeted genomic integration of fluorescent tags in neurons.  Read the paper in bioRxiv Find the...Transient expression of CRISPR/Cas9 in cells has advantages like reduced off-target activity and decreased...
  8. Designer PUF Proteins for Any RNA Target

    Type
    Blog Post
    ...– to specific sequences of DNA has become commonplace. This ability has opened up a world of possibilities...targeting the RNA of interest requires that the RNA be tagged. “This tool makes it possible to make the protein...protein specific to any endogenous RNA without tagging,” she said. “It opens a new avenue of modifying and...the original paper says). In their hands, BsaI-HF has produced less reliable results. She also notes that...
  9. Neurodegeneration Research Collection

    Type
    Collection
    ... Neurodegeneration Research Collection Addgene has assembled the following to help you find information...Parkinson's today. The Michael J. Fox Foundation has made a number of tools (Link opens in a new window...sporadic, having no prior family history. A small percentage (5-10%) are familial ALS cases having at least...
  10. Choosing the B(right)est Fluorescent Protein: Aggregation Tendency

    Type
    Blog Post
    ...conclude that mKOk has dimerization tendency and is not suitable for protein tagging. On the other hand...guarantee that using this fluorescent protein to tag your protein of interest will be problem-free. In...of different fluorescent proteins when protein tagging is the goal (Cranfill et al, 2016; Constantini ...Addgene.org Find Empty Backbones with Fluorescent Tags Find Plasmids for Subcellular Localization Browse...analytical ultracentrifugation yields an affinity and has been used to demonstrate that yellow fluorescent ... cells. Strikingly, the OSER assay reveals that tagRFP does not act as a true monomer in cells (Constantini...
  11. A Practical Approach to Choosing the B(right)est Fluorescent Protein

    Type
    Blog Post
    ...cellular variation observed in mammalian cells is to tag an endogenous gene. By imaging cells (or tissues)...tissues) that produce an endogenous protein tagged with a fluorescent protein and repeating this with another...co-expressing fluorescent proteins or using endogenous tagged genes) can be used to verify performance under ...Addgene.org Find Empty Backbones with Fluorescent Tags Find Plasmids for Subcellular Localization Browse...well or cannot be detected in a microscopy setup has zero practical brightness and is of no use. Therefore... practical brightness can be made. This strategy has been used in yeast by Lee et al (2013) and in nematodes...
  12. No Llamas Required - Synthetic Nanobodies Against Membrane Proteins

    Type
    Blog Post
    ...which attaches a Myc-tag and a His6-tag to the end of each sybody candidate. These tags are used in a final...selection step using ribosome display because it has the advantage of starting out with a larger initial starting...antibodies bound to an ELISA plate to capture Myc-tagged sybodies. Then, the biotinylated target protein...pBXNPHM3 expression plasmids for the production of tag-free proteins for further characterization and analysis... inhibit these viruses.  But llama immunization has its drawbacks: it requires a camelid animal facility...Walter et al., 2020). No llamas required. The advantages of synthetic nanobodies Nanobodies are small ...
  13. Resolute Plasmid Collection

    Type
    Collection
    ...and pharmaceutical companies. The RESOLUTE project has received funding from the Innovative Medicines Initiative... protein thermal stabilization, and changes of voltage all contribute to assess ligand action/engagement...
  14. Fluorescent Proteins 101: Green Fluorescent Protein (GFP)

    Type
    Blog Post
    ...GFP for a wide number of functions, including: tagging genes for elucidating their expression or localization...technology is constantly being developed! Fusion tagging: One of the most common uses, GFP can be fused ...Purification: GFP can be used as a general epitope tag for protein purification and a number of commercial...proteins such as Green Fluorescent Protein (GFP) has likely existed in creatures such as jellyfish for...from the crystal jellyfish Aequorea victoria. It has a fluorescent emission wavelength in the green portion...protein isolated from Discosoma sp. Similar work has been done to expand the red-fluorescent protein repertoire.... Split EGFP: An alternative to FRET, split EGFP has also been used to study protein-protein interactions...
  15. Announcing the Winners of the 2021 Michael Davidson and Roger Tsien Commemorative Conference Awards

    Type
    Blog Post
    ...calcium, and membrane voltage,” says Tian. Figure 5: Citrine-tagged voltage indicator expressed ...they occur.  First, she used a genetic method to tag neurons activated by opioid withdrawal with tdTomato...neuron (via hM4D). She fused fluorescent protein tags to the receptors to monitor their localization and...developing and optimizing biosensors in the lab. He has recently developed a third-generation intensiometric...release from hundreds of synapses at once. “This work has only been made possible due to the collaborative ... at the German Cancer Research Center (DKFZ) who has developed new redox sensitive GFP2 (roGFP2)-based...Qiu’s work on the PV neurons is in progress, she has validated the dual virus method to study CR neurons...
  16. Google Forums Round Up: First Impressions of NgAgo

    Type
    Blog Post
    ...technique for epitope tagging but only one of them could detect knock-in of tags at a target site. Overall...epitope tagging). NgAgo survey Since it was first published in Nat Biotech in May 2016 (1), NgAgo has received...THE ORIGINAL NgAgo ARTICLE DISCUSSED IN THIS POST HAS BEEN RETRACTED AND FOLLOW UP STUDIES HAVE FAILED ...spotlight and take a moment to remember that NgAgo has only been available for genome editing for a few ... synthesis, which could be less desirable if one has to target multiple sites in a single experiment. ...received much attention and the plasmid has been requested by labs around the globe nearly 400 times. Researchers...functional tests. The newest genome engineer sharing the stage with much-lauded CRISPR-Cas9 is DNA-guided endonuclease...
  17. Anatomy of a Plasmid Page at Addgene

    Type
    Blog Post
    ...empty vector with a tag, it’s terminus will be listed as the most likely terminus the tag will end up on after...its own gene/insert section on the plasmid page. Tags are listed according to whether they’ll end up on...popularity. A yellow flame indicates that a plasmid has been ordered more than 20 times; red, more than 50...available through Addgene. Publication: If the plasmid has been published, the paper in which it was first used... their new plasmid.  The Addgene Vector Database has more information about common vector backbones.  ...plasmid number here. Gene/insert: This describes what has been inserted into the backbone, and provides information...gene or DNA element of interest. If the depositor has indicated that there is a particular mutation found...
  18. Retrograde AAV viral preps

    Type
    Collection
    ...105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn EGFP-tagged Cre expression Recombinases James M. Wilson 105551...pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII GFP-tagged Cre expression Recombinases James M. Wilson 105553...Activator DREADD Bryan Roth 121539 pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) Syn Activator DREADD Christopher Richie ...See our retrograde AAV based on the functional catagories listed below. Narrow down the items available...
  19. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...cytoskeleton or blocking membrane trafficking. Addgene has assembled a collection of fluorescent fusion proteins...protein of interest with a fluorescent protein that has a different emission wavelength. For example, if ...mScarlet-I Dorus Gadella 50057 pLYS1-FLAG-MitoGFP-HA Mitochondria MCU GFP Vamsi Mootha 49153 GFP-Mff Mitochondria-Outer...Voeltz 79802 pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc...Mothes 79806 pTag-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-...endosomes Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagRFP James Johnson...EEA1 GFP Silvia Corvera 42635 TagRFP-T-EEA1 Early endosomes EEA1 TagRFP-T Silvia Corvera 38770 pEF.myc.ER-E2...
  20. Tips for Using FRET in Your Experiments

    Type
    Blog Post
    ...Bacterial Expresses Aquamarine with N-terminal His tag pAquaN1 Cyan Mammalian Expresses mammalian optimized...Cyan Bacterial Expresses CyPet with C-terminal His tag SCFP3A Cyan Mammalian Express a gene of interest...Yellow Bacterial Expresses YPet with C-terminal His tag SYFP2 Yellow Mammalian Express a gene of interest... in situ. Used since the mid-90s, this technique has revolutionised the way we apprehend molecular complexes...protein interactions in living cells. Since then FRET has also been used to measure conformational changes,...brightness - even though in the most popular pair, CFP has five-fold less brightness than YFP. The stoichiometry...Fluorescence lifetime imaging microscopy method FLIM has been developed more recently and is the most rigorous...
  21. Hot Plasmids September 2018 - Optogenetics, RNA Localization, Fluorescent Protein, and Base-editing Tools

    Type
    Blog Post
    ...These new “Riboglow” probes contain a smaller RNA tag, are less prone to photobleaching, and achieve better...compared to imaging with broccoli aptamers or MS2 tags using the same number of fluorophores. You can find... dark but dissociate under blue light. This tool has now been modified by Torsten Wittmann’s lab at UCSF...genetic or pharmacological manipulations on cells, and has potential use for a wide range of applications in...monomeric, 4-5 fold brighter than mNeptune684, and has a favorable pKa of 5.6. To test out this new FP in...The increasing popularity of single base-editors has resulted in the rapid expansion of the genome editing...expansion of genome editing tools, the Reuben Harris lab has deposited a reporter plasmid that allows for rapid...
  22. Multiplexed Capture of Promoter-enhancer 3D Chromatin Structures Using CRISPR

    Type
    Blog Post
    ... Replace the biotinalatable tag on dCas9 with a BioTAP-tag. The BioTAP-tag is a 69 aa long biotinylation... lentiviruses delivering 1) a BioTAP-tagged dCas9 and an eGFP tag, and 2) gRNAs Number of loci targeted...normally expressed in eukaryotic cells. Using this tag reduces the number of CAPTURE components that need...from three to two. Lentiviral delivery of BioTAP-tagged dCas9 and gRNAs. Using lentiviral delivery of the...system Stable cell line expressing 1) FLAG-biotin-tagged dCas9, 2) BirA, and 3) one or more gRNAs Two separate... original CAPTURE method is that a new cell line has to be created for each genomic loci of interest. ...
  23. Hot Plasmids: Summer 2025

    Type
    Blog Post
    ...presynaptic vesicle protein (VAMP2) and an epitope tag (ALFA-tag, or At) for easy visualization. A cleavage site...CRISPR has become a household name, the search for smaller genome editors is heating up and TnpB has found... of ATLASCre. VAMP2 = synaptobrevin 2; At = ALFA-tag; BACE = β-secretase; AF = AMPA.FingR; FingR = fibronectin...planning on lounging poolside or swimming laps, Addgene has pooled libraries for any summer project. While many...neurons. Created with BioRender.com. Addgene has tested these capsid plasmids in vitro and uses them...
  24. Deck the Lab 2022!

    Type
    Blog Post
    ...Twitter or Instagram by December 31, 2022.  Follow @Addgene, use the hashtag #DeckTheLab, and tag @Addgene...and then share them on Twitter or Instagram with #DeckTheLab and tagging us, @addgene to be judged! In ...this post on Instagram                     A post shared by Xi Chen (@seleena78) The lab has officially...December 12, 2022          View this post on Instagram                     A post shared by 草方 (@gracie_fang...get you out of.           View this post on Instagram                     A post shared by Xi Chen...and reveal the winning entries on Twitter and Instagram! Happy decorating, all, and to all a good light...
  25. Hot Plasmids and Viral Preps - May 2021

    Type
    Blog Post
    ...GFP to enhance axonal labeling and synaptophysin-tagged mRuby to enrich pre-synaptic labeling. Now available...tdTomato and pre-synaptic targeted synaptophysin tagged eGFP. AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE...a ready-to-use AAV5 viral vector. Synaptophysin-tagged GCaMP6s is enriched in the pre-synaptic terminal...pathways By Gabrielle Clouse Claudia Vickers’ lab has created a novel nanocompartment for transporting ...Staphylococcus lugdunensis that recognizes a NNGG PAM and has comparable activity to SaCas9. A new yeast inducible...that is smaller and easier to deliver, but so far has few inhibitors identified.     New from the viral...
  26. Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior

    Type
    Blog Post
    ...CFP, or YFP fluorescence. In Brainbow 2.1, GFP is tagged with a nuclear localization sequence, allowing ...developed a version of Tetbow that incorporates chemical tags instead of XFP to optimize it for tissue clearing...architecture of a fluorescent neuron is visible. Chemical tags are more resistant to tissue clearing methods and... circuits with fluorescent proteins and chemical tags." eLife 7 (2018): e40350. PubMed PMID: 30454553....track single cell dynamics at the organism level has been made possible by tools that allow cells to become... such as neurons in the fly visual system, which has been difficult to study previously (Hadjieconomou...of cells in the intestinal crypt, and since then has become a powerful tool for understanding cell proliferation...
  27. Retrovirus Plasmids

    Type
    Collection
    ... expresses GFP. Also see pMIG-w , a variant that has WRE, a post-transcriptional regulatory element that...results in long-term transgene expression. Some disadvantages of γ-retroviruses are that they can only transduce... can lead to oncogenesis (termed insertional mutagenesis). Read our γ-Retrovirus Guide for more information...
  28. Sequencing Primers

    Type
    Guide
    ...forward primer HA-F TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse primer...Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator...Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT 3' end...Reference Sequencing Primers Sequencing Primers Addgene has used a number of primers for sanger sequence verification...GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end... primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator...Reverse ACCGAGGAGAGGGTTAGGGAT (Invitrogen) V5 epitope, reverse primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end...
  29. Molecular Biology Reference

    Type
    Guide
    ...prokaryotes. Common Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL...nucleotides. Epitope tags on the other hand are commonly used in molecular cloning to tag a gene within a ...random incorporation of modified, fluorescently tagged bases onto the growing DNA strand in addition to...T, C, or G nucleotide. The 4 standard bases are tagged with a different fluorophore so they can be distinguished...when the polymerase incorporates a fluorescently tagged nucleotide. Because these special bases do not ..., the reaction is halted once the fluorescently tagged base is incorporated. Sanger sequencing requires...because the ultimate goal is to have a fluorescently tagged nucleotide at each position in the DNA sequence...
Showing: 91 - 120 of 527 results