...researchers did not have access to a P3 laboratory (BSL-3), a high-security facility needed to perform the experiments...Confirm the expert’s suitability and availability; 3) Make the contact to start a direct collaboration ...IgnacioAmigoH     María Hernández-Sánchez is a postdoctoral researcher at Instituto de Investigación Biomédica...

...stable gRNA than when they inserted the aptamer at the 3’ end of the gRNA. Because of the success of the MS2...can be increased from 2-fold (by CRISPRainbow) to 3-fold with CRISPR-Sirius. Triple color detection With...candidates for further development. They inserted an octet of MS2 hairpins into the gRNA tetraloop and went...

...some impressive videos of these interactions (Ref 3). You can find useful tips on in vivo imaging in our...Research 9.12 (2016): 895-905. PubMed PMID: 27913448. 3. Cai, En, et al. "Visualizing dynamic microvillar ...Relationship” by our guest blogger Subhadra Jayaraman, a doctoral candidate at Binghamton University! Cancer therapeutics...

...symposium on the future of the scientific endeavor October 2-3, 2014 Boston University Jacob Sleeper Auditorium...article - you should join Dr. Bourne in Boston on October 2nd when he will be the keynote speaker for the...

...exchange, the government protects (and often funds [3]) scientists as well as other citizens. Thus civilization...depending on the number of people supporting it.  3) Linking scientists to one particular political party...request of this administration promises more cuts (3, 12, 13, 27). In order to achieve the breakthroughs...active research scientists (scientists who hold a doctorate degree, are currently working full-time, and have...

... cover letter can be found on the Addgene blog.   3. Personal statement brilliance In addition to sending... Letters of recommendation wisdom  Reach out to 2-3 individuals in your professional circle to vouch for...Pierre! Roodolph (Roo) P. St Pierre is currently a doctoral candidate in the Chemical Biology Program at Harvard...

... back to a pluripotent stage (iPSC formation) [2, 3]. The iPSCs then proliferate and redifferentiate to..., 2007. 131(5): p. 861-72. PubMed PMID: 18035408. 3. Takahashi, K. and S. Yamanaka, Induction of pluripotent...converting one cell into another. Cell Stem Cell, 2008. 3(4): p. 382-8. PubMed PMID: 18940730. Additional Resources...involves overexpression of four reprogramming factors- OCT4, SOX2, KLF4, and C-MYC - that induce a differentiated...communication and publishing after completing her postdoctoral training from Massachusetts General Hospital...

...PMID: 27175853. Pubmed Central PMCID: PMC4866822. 3. McDowell, Gary S., et al. "Shaping the Future of ...perspective from junior scientists."F1000Research 3 (2014). Pubmed PMID: 25653845. Pubmed Central PMCID...working group (National Academy of Sciences. “The Postdoctoral Experience Revisited” 2014 Appendix B p93-95...

...materials required for each [1, 2]. This protocol [3] provides, in exquisite detail, the various steps ...doi: 10.1038/nprot.2011.413. PubMed PMID: 22157972. 3. Britt JP, et al. Use of channelrhodopsin for activation...University of Michigan and he is currently a Postdoctoral Fellow in the lab of Mary Jeanne Kreek at the...

...not immunogenic, a necessity for in vivo studies; (3) is compatible with single gene KO and pooled screening... Find FITS plasmids here! Marty LaFleur is a Postdoctoral Fellow in Arlene Sharpe’s laboratory at Harvard...

...the impact of research" (2013) Scientific Reports 3, Article number: 1649 doi:10.1038/srep01649     ...been gaining ground. A study issued by Google in October entitled “Rise of the Rest: The Growing Impact ...

...be used with targets that are upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is this gRNA... Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens ...GTGAATGATGATAATACGAT 64160 activate S. pyogenes 25619936 Sato Oct4A (POU5F1) H. sapiens GGGGCGCCAGTTGTGTCTCC 50922 interfere... interfere S. pyogenes 24346702 Wolfe Oct4A (POU5F1) H. sapiens GTGGGACTGGGGAGGGAGAG 50921 interfere S...CGAAATGAGAAAGGGAGCTACAAC 47869 cut N. meningitidis 23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N....

... kb at most - which means that a gene larger than 3 kb cannot be delivered using this vector. For example...emerges from disgrace to be the next big thing, again 3. Acland G. et al., 2001. Gene therapy restores vision...amaurosis. This is the first of what I, scientists, doctors and patients hope are many more clinical successes...

... Consulting firms deploy case teams, usually with 3-6 consultants, who work on analyzing the situation...the client to prioritize investments over the next 3, 5, or 10 years. Complicating these challenges is ...given therapeutic approach brings to patients, doctors, and insurance providers, and is crucial to how...

... of the optical fiber into the region of interest 3) Behavioral experimentation I’ll discuss some of the...thoroughly elsewhere (here and here for instance) [2], [3]. Karl Deisseroth of Stanford University , one of ...10.1146/annurev-neuro-061010-113817. PMID: 21692661.  3. Bernstein JG, Boyden ES. Optogenetic tools for analyzing...University of Michigan and he is currently a Postdoctoral Fellow in the lab of Mary Jeanne Kreek at the...

... enhanced sodium accumulation in their roots and (3) development of tools for data analysis/visualization...post was contributed by Magdalena Julkowska, a postdoctoral researcher at KAUST, Saudi Arabia. From the... submission to the subsequent journal.  As a postdoctoral researcher studying plant development and abiotic...

...one company, likely will need to move around every 3-6 years—a short and exciting ride Complicated matrix...recently, I have been hearing exit survey data from postdoctoral programs in the Boston area that demonstrate...Both explicit and implicit aspects of today’s postdoctoral training can directly interfere with a seamless...

... for a Successful Collaboration. PLoS Comput Biol 3:e44 . https://doi.org/10.1371/journal.pcbi.0030044...This post was contributed by Matteo Tardelli, a postdoctoral scientist at Weill Cornell Medicine. Discussing...blogger Matteo Tardelli! Matteo Tardelli, PhD is Postdoctoral Scientist at Weill Cornell Medicine in NYC and...

... to have either salaries raised or hours tracked, 3% of postdocs were at institutions focused only on ...of Information Act (FOIA) requests for their postdoctoral salary information as of December 1st. Salary...are an important step forward in helping the postdoctoral population continue to pursue academic work,...of the scientific enterprise by reducing the postdoctoral population which keeps growing despite a lack...

...that could be useful for a wide variety of reasons. 3) I would love to see more posts like this on the Addgene...deposited plasmids on this trip. Here’s to hoping that October is even more awesome than September! Tyler J. Ford...