Skip to main content
Addgene
Showing: 1 - 16 of 16 results

  1. p53 Pathway

    Type
    Collection
    ...each gene page are provided below. Symbol Name 14-3-3-σ Stratifin Apaf-1 Apoptotic peptidase activating...CCNB2 CCNB3 Cyclin B1, 2, or 3 Cyclin D CCND1 CCND2 CCND3 Cyclin D1, 2, or 3 Cyclin E CCNE1 CCNE2 Cyclin...p53 field. Brosh R, Rotter V. Nat Rev Cancer. 2009 Oct;9(10):701-13. PubMed PMID: 19693097 . The expanding...Menendez D, Inga A, Resnick MA. Nat Rev Cancer. 2009 Oct;9(10):724-37. PubMed PMID: 19776742 . Germline TP53...BH3 interacting domain death agonist CASP3 Caspase 3, apoptosis-related cysteine peptidase CASP8 Caspase...IGF-BP3 Insulin-like growth factor binding protein 3 KAI CD82 molecule Maspin Serpin family B member 5 ...reductase M2 B (RRM2B) PAG608 Zinc finger, matrin-type 3 PAI Serpin peptidase inhibitor, clade E (nexin, plasminogen...

  2. Zhang Lab CRISPR Page

    Type
    Collection
    ...) and need to be followed on the 3' end by a 3bp NGG PAM sequence. 3. SpCas9 alone: This plasmid contains....2013.08.021. Epub 2013 Aug 29. Erratum in: Cell. 2013 Oct 10;155(2):479-80. PubMed . Genome engineering using...2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. PubMed . Return to SpCas9 plasmids GeCKO Library...Jan;33(1):102-6. doi: 10.1038/nbt.3055. Epub 2014 Oct 19. PubMed . In vivo genome editing using Staphylococcus... Regev A, Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi: 10.1016/j.cell.2014.09.014....site sequence (20bp) and need to be followed on the 3' end by a 3bp NGG PAM sequence. We have found that...Targeted gene activation using SAM There are two sets of 3 vectors each available for mammalian endogenous gene...

  3. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...interneurons across vertebrate species. Nat Neurosci. 2016 Oct 31. Gordon Fishell Calcium GCaMP5 genetically encoded...indicator for neural activity imaging. J Neurosci. 2012 Oct 3;32(40):13819-40. Baljit Khakh , Douglas Kim , Loren...marking active neuron populations. Nat Commun. 2018 Oct 25;9(1):4440. Eric Schreiter Calcium AAV expression...intracellular Zn(2+) homeostasis. Nat Methods. 2009 Oct;6(10):737-40. Maarten Merkx Zinc eZinCh-2 Zn2+ FRET... Secretion of Pancreatic Islets. Anal Chem. 2019 Oct 1;91(19):12212-12219. Huiwang Ai Zinc GZnP2 Cytosolic... Encoded Fluorescent Biosensor. Cell Metab. 2011 Oct 5;14(4):545-54. Gary Yellen NADH/NAD+ Peredox fluorescent... for in vivo phosphate tracking. FEBS Lett. 2006 Oct 30. 580(25):5885-93. Wolf Frommer Pyruvate Pyronic...

  4. Tetracycline Inducible Expression

    Type
    Collection
    ...Pfleiderer K, Hillen W, Berens C. Biotechniques . 2004 Oct;37(4):546, 548, 550. PubMed . Optimization of the..., Klaver B, Berkhout B, Das AT. Gene Ther . 2006 Oct;13(19):1382-90. PubMed . Improved Tet-responsive ...Lentiviral reverse tetracycline-controlled transactivator 3 (rtTA3) expression vector, CMV promoter, and Blasticidin...tTA at its 5' end and an inducible promoter at its 3' end, which controls GFP expression tTA Off Verma ...contains insulator sequence; plasmid pEnt L1L3 rtTA-3 is a rtTA version tTA Off Hsiao 34856 fos-tTA Mouse...plus part of the first intron (-764/+918) and fos 3'UTR tTA Off Mayford 38056 pXCX.CMV.tTA Adenoviral;...Oesch F, Zabel B. Physiol Genomics . 2002 Dec 3;11(3):115-32. PubMed . Tetracycline derivatives: alternative...

  5. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495. PMID: 27759036 Other citations include...Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495. PMID: 27759036 Rosario, et al. 2016. ...tyrosine-mutant AAV serotype vectors. Mol Ther . 2009 Mar;17(3):463-71. PMID: 19066593 Other citations include: Bogner...cell entry characteristics. Gene Ther . 2020 Apr;27(3-4):127-142. PMID: 31611639 AAV2(trpYF) When using ...Expressing Retinoschisin. Hum Gene Ther Clin Dev . Sep;26(3):165-76. PMID: 26390090 Other citations include: Scalabrino...

  6. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...following primers: FW 5'–GGTGACGGTGCTGGTTTA–3' RV 5'–TCGATGAATTCGAGCTCG–3' ID Plasmid Selectable Marker Tags Publication...Saccharomyces cerevisiae. Microb Cell Fact. 2013 Oct 25;12:96. doi: 10.1186/1475-2859-12-96. PubMed 24161108...

  7. Neurodegeneration Research Collection

    Type
    Collection
    ...between Rab12 and LRRK2 . Dhekne et al. Elife. 2023 Oct 24. See More CRISPR Tools Find CRISPR pooled libraries...target alpha-synuclein. Sastre et al. Sci Rep. 2023 Oct 18. Target neural oxytocin receptors using an AAV-CRISPR...dopaminergic activity in vivo. Sun et al. Nat Methods. 2020 Oct 21. Glutamate indicators with improved activation... and breathing, and often results in death within 3-5 years from symptom onset. Disease mechanisms are...

  8. Jaenisch Lab CRISPR Plasmids

    Type
    Collection
    ...Shivalila CS, Dadon DB, Jaenisch R. Cell Res. 2013 Oct;23(10):1163-71. doi: 10.1038/cr.2013.122. Epub 2013...(puro-selectable) on pmax expression vecor. Table 3. dCas9 Activators Gateway Donors ID Plasmid 48214 ...

  9. Plasmids for Stem Cell Research

    Type
    Collection
    ...cells to pluripotency. Cell Stem Cell. 2008 Sep 11. 3(3):346-53. Jaenisch Lentivirus Human Single polycistronic...Developmental Potential of iPSCs. Cell Stem Cell. 2019 Oct 30. pii: S1934-5909(19)30423-0. Schöler You can also...MicroRNA-Dependent Direct Conversion of Fibroblasts. Neuron. 2014 Oct 22;84(2):311-23. Yoo Fibroblasts Neurons Lentiviral...reprogramming in mouse. Cell Stem Cell. 2008 Mar 6. 2(3):230-40. Hochedlinger MMLV-derived Retrovirus Mouse...gene expression signatures. Cell Res. 2011 Mar;21(3):518-29. Cheng piggyBac Mouse Doxycycline-inducible...by Defined Factors. Cell Stem Cell. 2012 Sep 7;11(3):373-86. Jaenisch Fibroblasts Hepatocytes Retroviral...defined factors. Nature. 2011 Jun 29;475(7356):390-3. Suzuki Pancreatic Exocrine Cells Beta-cells Adenoviral...

  10. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...with four different phosphobinding domains (14-3-3β, 14-3-3σ, the WW2 domain of NEDD4, and the WW2 domain...111881 pNAS1b split mCherry 14-3-3σ Plasmid 111880 pNAS1b split mCherry 14-3-3β Pooled Library 111704 Mode...111705 Mode #2 Library (14-3-3β) Pooled Library 111706 Mode #2 Library (14-3-3σ) Pooled Library 111707 ...Söll D, Isaacs FJ, Rinehart J. FEBS Lett . 2012. Oct 19;586(20):3716-22. PubMed (Link opens in a new window...iSPI_pSer_Subpool#2 Pooled Library 188528 iSPI_pSer_Subpool#3 Pooled Library 188529 iSPI_pSer_Subpool#4 Pooled Library...52055 EcAR7 Plasmid 112031 pNAS1b split mCherry 14-3-3β ctrl Plasmid 112030 pNAS1b split mCherry NEDD4 ...

  11. Fujii Lab CRISPR Plasmids

    Type
    Collection
    ...Yuno M, Suzuki Y, Sugano S, Fujii H. DNA Res. 2017 Oct 1;24(5):537-548. doi: 10.1093/dnares/dsx023. PubMed...2018 Jun 14;11(1):387. doi: 10.1186/s13104-018-3486-3. PubMed . Promoter-associated proteins of EPAS1 identified...

  12. Immunology Research Plasmids and Resources

    Type
    Collection
    ...immunoglobulin heavy diversity 3-22 IGHD322 IGHD3-3 immunoglobulin heavy diversity 3-3 DXP4, IGHD33 IGHD3-9 immunoglobulin...VH IGHV3-30-3 immunoglobulin heavy variable 3-30-3 IGHV3-3, IGHV3303 IGHV3-30-5 immunoglobulin heavy variable...motif) ligand 3-like 2 G0S19-3, LD78gamma, SCYA3L2 CCL3L3 chemokine (C-C motif) ligand 3-like 3 464.2, D17S1718... variable 3-30-5 IGHV3-3, IGHV3305 IGHV3-33 immunoglobulin heavy variable 3-33 IGHV333, VH IGHV3-35 immunoglobulin...lambda variable 3-9 (gene/pseudogene) IGLV39, V2-6 IGLV4-3 immunoglobulin lambda variable 4-3 IGLV43, V5-1..., MRS DEFA3 defensin, alpha 3, neutrophil-specific DEF3, HNP-3, HNP3, HP-3 DEFA5 defensin, alpha 5, Paneth...

  13. Genetic Code Expansion

    Type
    Collection
    ...nitroY/haloY-F5 PylRS M. alvus 3-nitrotyrosine (3-nitro-Y), 3-halotyrosine (3-halo-Y) Bacterial TAG Ryan ... Ryan Mehl 85498 pDule-3-nitroTyrosine (5B) 3NY (5B) synthetase M. jannaschii 3-nitroTyrosine Bacterial...Ryan Mehl 85499 pDule2-3-nitroTyrosine (5B) 3NY (5B) synthetase M. jannaschii 3-nitroTyrosine Bacterial.... jannaschii 3-aminotyrosine Bacterial TAG Huiwang Ai 153558 pMAH-EcaYRS EcaYRS E. coli 3-aminotyrosine...Jason W Chin 174078 pDule-3-nitroTyrosine (A7) 3NY (A7) synthetase M. jannaschii 3-nitroTyrosine Bacterial...Ryan Mehl 174079 pDule2-3-nitroTyrosine (A7) 3NY (A7) synthetase M. jannaschii 3-nitroTyrosine Bacterial...trans-cyclooct- 2-ene-lysine (TCOK) Mammalian TAG Howard Hang 126035 pEVOL-ABK PylRS M. barkeri 3’-azibutyl-N-carbamoyl-lysine...

  14. Zebrafish Plasmid Collection

    Type
    Collection
    ...development (embryogenesis is complete in ~3 days), short generation time (~3 months), ease of care and breeding...ALS-linked aggregates in real time. Live imaging of astroctyes - Kelly Monk Lab. Live imaging tools to study...

  15. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...pBAD-LSSmOrange - Bacterial Expression mKeima Red 440 620 3 6.5 4.4 hr Monomer pFA6a-link-yomKeima-CaURA3 - Yeast...dKeima-Red-N1 - Mammalian Expression LSSmKate1 463 624 3 3.2 1.7 hr Monomer pLSSmKate1-N1 - Mammalian Expression...HisB-PAmKate - Bacterial Expression PAiRFP1 690 717 3 Dimer pPAiRFP1-N1 - Mammalian Expression pBAD/HisB-PAiRFP1...HisB-PAiRFP1 - Bacterial Expression PAiRFP2 692 719 3 Dimer pPAiRFP2-N1 - Mammalian Expression pBAD/HisB-PAiRFP2... al. : Nature Communications, November 2012, Vol. 3 No. 1204 Wiedenmann et al. : Journal of Biomedical...pp. 7913–7923 Hoi et al. : Chemistry & Biology, October 2013, Vol. 20 No. 10, pp.1296-304 Kogure et al....

  16. Validated gRNA Sequences

    Type
    Collection
    ...be used with targets that are upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is this gRNA... Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens ...GTGAATGATGATAATACGAT 64160 activate S. pyogenes 25619936 Sato Oct4A (POU5F1) H. sapiens GGGGCGCCAGTTGTGTCTCC 50922 interfere... interfere S. pyogenes 24346702 Wolfe Oct4A (POU5F1) H. sapiens GTGGGACTGGGGAGGGAGAG 50921 interfere S...CGAAATGAGAAAGGGAGCTACAAC 47869 cut N. meningitidis 23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N....
Showing: 1 - 16 of 16 results