Skip to main content

We narrowed to 5 results for: 3-Oct

Showing: 1 - 5 of 5 results
  1. Sequencing Primers

    Type
    Guide
    ...ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector/td> Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX... For pBluescript vector Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of MCS in pGEX vectors Reverse ...Sequencing Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia...GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain Forward Gal4-AD AATACCACTACAATGGAT 3' end of Gal4 activation...S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG 3' end of Gateway cassette Forward GW-5'...GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose binding protein Forward mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry... pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...
  2. Molecular Cloning Techniques

    Type
    Guide
    ... interest into fragments containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang...Gateway attB1 and attB2 sites attached to the 5’ and 3’ ends of the DNA sequence. This fragment can then ...which naturally leaves a single A overhang on the 3' end of PCR products. The complementary T comes from...covalently bound to the phosphate group on the free 3' T. The topoisomerase acts as a ligase that joins ... Read more in our TOPO Cloning blog post . Figure 3: Summary of TOPO cloning. TOPO = topoisomerase I. ... Ligation Independent Cloning (LIC) relies on the 3' to 5' exonuclease activity of T4 DNA polymerase. ...Plasmids cloning topics Content last reviewed: 22 October 2025...
  3. Promoters

    Type
    Guide
    ...example of a negatively-controlled operon (Figure 3). A positive-repressible operon works in the opposite...example of a positively-controlled operon. Figure 3: Lac operon regulation. Created with BioRender.com...proteins) make up the transcription complex. The most 3' portion (closest to the gene's start codon) of the...Constitutive Yeast Very strong promoter from glyceraldehyde 3-phosphage dehydrogenase; also called TDH3 or GAPDH... Plasmids 101 topics Content last reviewed: 22 October 2025...
  4. Optogenetics Guide

    Type
    Guide
    ...function of the neuron. Archaerhodopsins Archaerhodopsin-3 (Arch) from Halorubrum sodomense and its variants ...reversible dimerization of Phytochrome Interacting Factor 3 or 6 (PIF3 or PIF6) with PhyB 660 PhyA/FYH1 and PhyA...chemical-genetic control of neurons. PLoS ONE, 8 (3), e59759. https://doi.org/10.1371/journal.pone.0059759...: A Retrospective and a Look Ahead. Adv Genet, 6 (3), e00021. https://doi.org/10.1002/ggn2.202500021 PMID...with single-spike temporal resolution. PLoS ONE, 2 (3), e299. https://doi.org/10.1371/journal.pone.0000299... of distinct neural populations. Nat Methods, 11 (3), 338–346. https://doi.org/10.1038/nmeth.2836 PMID...of neural activity. Cold Spring Harb Protoc, 2011 (3), top102. https://doi.org/10.1101/pdb.top102 PMID:...
  5. Molecular Biology Reference

    Type
    Guide
    ...chain-termination sequencing or dideoxy sequencing (Figure 3). Sanger sequencing relies on the random incorporation... efficient and reliable sequencing method. Figure 3: Summary of Sanger sequencing. Created with BioRender.com.... Uracil replaces thymine in RNA molecules. Every 3 nucleotides (codons) in a DNA sequence encodes for...blog Addgene Protocols Content last reviewed: 22 October 2025...
Showing: 1 - 5 of 5 results