Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 83 results for: ARAB-1

Showing: 61 - 80 of 83 results

  1. Antibodies 101: Reading a Flow Plot

    Type
    Blog Post
    ...Figure 1). Clustered events are called a population.                             Figure 1: While...the King Abdulaziz University, Kingdom of Saudi Arabia. Bioinformation, 14, 53–59. https://doi.org/10.6026...

  2. Fluorescent Proteins 101: Fluorescent Biosensors

    Type
    Blog Post
    ...of experiments they are commonly used for.  Table 1. Points to Keep in Mind When Performing Biosensor ...measure the concentration of small molecules like arabinose or hydrogen peroxide or ions like calcium and ...

  3. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...SpCas9 base editors with editing windows as small as 1-2 nucleotides! To reduce off-target effects associated...Lower on-target activity than BE3; editing window ~1-2 nt  87438  pET42b-HF-BE3  HF-Cas9 (NGG)  Very ...from these polycistronic cassettes could lead to comparable experimental results. Using PiggyBac transposons...retaining an emission spectrum that is easily separable from that of EGFP. This makes mCyRFP1 a powerful...

  4. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...a rate of up to 1 per 500-1000 bp. In comparison, the DNA replication error rate is 1 per 109 bp. Unlike...benthamiana and Arabidopsis. The authors found that deletion efficiency was dependent upon 1) Cas9 and gRNA...Transcriptional Output-TANGO (PRESTO-TANGO) to screen the NCC-1 library of approved drugs against the entire kit; ...generated 5 common 30bp overlap sequences (Sites #1-5). Each overlap site encodes a unique restriction...First, GMAP-compatible backbones for lentivirus LV 1-5 and retrovirus RV 2-5 were constructed. The authors...is multiplex automated genome engineering (MAGE) (1). MAGE uses recombineering (2) to simultaneously incorporate...of GFP (SEP) by a 9 amino-acid linker (see Figure 1). The key to the biosensor lies in pH: DsRed is relatively...

  5. CRISPR 101: Engineering the Plant Genome Using CRISPR/Cas9

    Type
    Blog Post
    ...target cell line or organism (Presented in figure 1). More information on Agrobacterium-mediated transformation...mediated cloning of your gRNA of interest. Figure 1: Simplified schematic of agrobacterium-mediated transformation...including commonly used model organisms like Arabidopsis and Medicago truncatula and several crop species...

  6. Antibodies 101: Multiplex Immunofluorescence

    Type
    Blog Post
    ...et al., 2019; McLaughlin, 2019).    Figure 1: Schematic of multiplex immunofluorescence approaches...). Springer New York. https://doi.org/10.1007/978-1-4939-8935-5_26 Jambor, H., Antonietti, A., Alicea,...Ilangovan, V., Lo, H., Olson, M., Mohamed, S. Y., Sarabipour, S., Varma, A., Walavalkar, K., Wissink, E. M...

  8. Scientists Map the SARS-CoV-2-Human Interaction Network

    Type
    Blog Post
    ...faster. Years of science, done in weeks Figure 1: Sending out 80 FedEx envelopes in a single day --...as far flung as the EU, Russia, India and Saudi Arabia -- as well as closer to home in the US and Canada...

  9. Sharing is Caring: But How to Distribute Open Hardware?

    Type
    Blog Post
    ...accessible to practically everyone.     Fig. 1: Open source hardware builds   Since I started...in developing better, more sustainable, easily sharable products. Open-Source Microscopy Sharing Hardware...

  10. Summer SciComm: Preprints

    Type
    Blog Post
    ...medRxiv.org) in the past few years.   Figure 1: Stand aside, CERN — it's a new age of accelerating...bioRxiv. https://doi.org/10.1101/2021.09.07.459259 Sarabipour S, Debat HJ, Emmott E, Burgess SJ, Schwessinger...

  11. What's New in CRISPR - November 2021

    Type
    Blog Post
    ... Science Find the SEND plasmids    Figure 1: SEND combines an endogenous Gag homolog, cargo RNA...activity of Cas12f1 with these modified gRNAs is comparable to that of SpCas9. The group also confirmed that...

  12. Sequencing Primers

    Type
    Guide
    ...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse.... coli araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter...

  13. CRISPR 101: Multiplex Expression of gRNAs

    Type
    Blog Post
    ...post about multiplexing with Cpf1.   Figure 1: Multiplexing allows researchers to express multiple...be used in a wide range of bacteria. References 1. Maddalo, Danilo, et al. “In vivo engineering of oncogenic...and Cas9, which are separately inducible by L-arabinose and anhydrotetracycline (aTet), respectively. ...

  14. Promoters

    Type
    Guide
    ... or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during transcription. ...Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate...induced by IPTG or lactose araBAD Inducible by arabinose Promoter of the arabinose metabolic operon trp Repressible...

  16. Hot Plasmids and Viral Preps - May 2021

    Type
    Blog Post
    ...(RBD) of the viral spike protein.   Figure 1. (A) SARS-CoV-2 RBD DMS Library generation and sequencing...lugdunensis that recognizes a NNGG PAM and has comparable activity to SaCas9. A new yeast inducible CRISPRi...

  17. An Inside Look into Addgene's Dev Team

    Type
    Blog Post
    ... done and we’re onto the next story. Figure 1: Addgene’s Agile Approach Sharing is caring There...happens, we need to research and hopefully find a comparable library if it’s gone stale or we will need to...

  18. The Challenges of Cell Culture

    Type
    Blog Post
    ...testing. You can find Nick on LinkedIn. References 1. Skloot, Rebecca, and Bahni Turpin. The immortal life...line identity and purity making it easier for comparable studies to be performed on a cell line even decades...
Showing: 61 - 80 of 83 results