We narrowed to 83 results for: ARAB-1

...new data). For general transfection, you could use 1 µl of 10 µM oligo stock for each well on 24-well plate...A10: The most we've tried to insert so far has been 1 kb. We used homology arms that were 800 bp long. Q11...able to cut). Clones without insertion will show a ~1 kb and ~7.5 kb fragment (both BbsI and AgeI will be...Mammalian Cells. Molecular and Cellular Biology, 18(1), 93–101. https://doi.org/10.1128/mcb.18.1.93  Ran...system, developed by the Zhang lab, which has comparable efficiency to the optimized chimeric design but...

...Figure 1). Clustered events are called a population.                             Figure 1: While...the King Abdulaziz University, Kingdom of Saudi Arabia. Bioinformation, 14, 53–59. https://doi.org/10.6026...

...of experiments they are commonly used for.  Table 1. Points to Keep in Mind When Performing Biosensor ...measure the concentration of small molecules like arabinose or hydrogen peroxide or ions like calcium and ...

...SpCas9 base editors with editing windows as small as 1-2 nucleotides! To reduce off-target effects associated...Lower on-target activity than BE3; editing window ~1-2 nt  87438  pET42b-HF-BE3  HF-Cas9 (NGG)  Very ...from these polycistronic cassettes could lead to comparable experimental results. Using PiggyBac transposons...retaining an emission spectrum that is easily separable from that of EGFP. This makes mCyRFP1 a powerful...

...a rate of up to 1 per 500-1000 bp. In comparison, the DNA replication error rate is 1 per 109 bp. Unlike...benthamiana and Arabidopsis. The authors found that deletion efficiency was dependent upon 1) Cas9 and gRNA...Transcriptional Output-TANGO (PRESTO-TANGO) to screen the NCC-1 library of approved drugs against the entire kit; ...generated 5 common 30bp overlap sequences (Sites #1-5). Each overlap site encodes a unique restriction...First, GMAP-compatible backbones for lentivirus LV 1-5 and retrovirus RV 2-5 were constructed. The authors...is multiplex automated genome engineering (MAGE) (1). MAGE uses recombineering (2) to simultaneously incorporate...of GFP (SEP) by a 9 amino-acid linker (see Figure 1). The key to the biosensor lies in pH: DsRed is relatively...

...target cell line or organism (Presented in figure 1). More information on Agrobacterium-mediated transformation...mediated cloning of your gRNA of interest. Figure 1: Simplified schematic of agrobacterium-mediated transformation...including commonly used model organisms like Arabidopsis and Medicago truncatula and several crop species...

...et al., 2019; McLaughlin, 2019).    Figure 1: Schematic of multiplex immunofluorescence approaches...). Springer New York. https://doi.org/10.1007/978-1-4939-8935-5_26 Jambor, H., Antonietti, A., Alicea,...Ilangovan, V., Lo, H., Olson, M., Mohamed, S. Y., Sarabipour, S., Varma, A., Walavalkar, K., Wissink, E. M...

.... You can email her at [email protected].   References 1. Huang, Ally, et al. "BioBits™ Explorer: A modular...in functional genomics research Learn how the Arabidopsis research center brings plant science to life ...

...of interest, inducing a lethal DSB. Figure 1: CRISPR selects against bacteria where no recombineering...in Streptomyces (Cobb et al., 2015). pCRISPomyces-1 includes Cas9, a tracrRNA, and a CRISPR array, while...INTEGRATE consists of four major components including (1) a CRISPR RNA, (2) four proteins forming the QCascade...and Cas9, which are separately inducible by L-arabinose and anhydrotetracycline (aTet), respectively. ...

...faster. Years of science, done in weeks Figure 1: Sending out 80 FedEx envelopes in a single day --...as far flung as the EU, Russia, India and Saudi Arabia -- as well as closer to home in the US and Canada...

...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse.... coli araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter...

...accessible to practically everyone.     Fig. 1: Open source hardware builds   Since I started...in developing better, more sustainable, easily sharable products. Open-Source Microscopy Sharing Hardware...

...medRxiv.org) in the past few years.   Figure 1: Stand aside, CERN — it's a new age of accelerating...bioRxiv. https://doi.org/10.1101/2021.09.07.459259 Sarabipour S, Debat HJ, Emmott E, Burgess SJ, Schwessinger...

... or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during transcription. ...Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate...induced by IPTG or lactose araBAD Inducible by arabinose Promoter of the arabinose metabolic operon trp Repressible...

... Science Find the SEND plasmids    Figure 1: SEND combines an endogenous Gag homolog, cargo RNA...activity of Cas12f1 with these modified gRNAs is comparable to that of SpCas9. The group also confirmed that...

...post about multiplexing with Cpf1.   Figure 1: Multiplexing allows researchers to express multiple...be used in a wide range of bacteria. References 1. Maddalo, Danilo, et al. “In vivo engineering of oncogenic...and Cas9, which are separately inducible by L-arabinose and anhydrotetracycline (aTet), respectively. ...

... little signal detected along the neurite (Figure 1.) Moreover, the group was able to demonstrate that... codon-optimized  cryptochrome 2 (CRY2) from Arabidopsis thaliana. When exposed to blue light, CRY2 undergoes...

...(RBD) of the viral spike protein.   Figure 1. (A) SARS-CoV-2 RBD DMS Library generation and sequencing...lugdunensis that recognizes a NNGG PAM and has comparable activity to SaCas9. A new yeast inducible CRISPRi...

... done and we’re onto the next story. Figure 1: Addgene’s Agile Approach Sharing is caring There...happens, we need to research and hopefully find a comparable library if it’s gone stale or we will need to...

...testing. You can find Nick on LinkedIn. References 1. Skloot, Rebecca, and Bahni Turpin. The immortal life...line identity and purity making it easier for comparable studies to be performed on a cell line even decades...