We narrowed to 2 results for: ARAB-1

...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse.... coli araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter...

... or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during transcription. ...Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate...induced by IPTG or lactose araBAD Inducible by arabinose Promoter of the arabinose metabolic operon trp Repressible...