Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 100 results for: EGFP

Showing: 61 - 80 of 100 results

  1. Brain Armamentarium

    Type
    Collection
    ...pAAV-AiE0873m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN5140) Expression of CoChR-EGFP in striatal cholinergic...pAAV-AiE0452h_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN4035) Expression of CoChR-EGFP in striatal indirect pathway...pAAV-AiE0779m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN4033) Expression of CoChR-EGFP in striatal direct pathway...

  2. Brain Initiative Collection

    Type
    Collection
    ...198513-AAV1 pAAV_hSyn-PdCO-EGFP-WPRE Expresses optimized PdCO in frame with EGFP under control of human synapsin1...198513-AAV5 pAAV_hSyn-PdCO-EGFP-WPRE Expresses optimized PdCO in frame with EGFP under control of human synapsin1...pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE Expresses bicistronically soma-targeted ChrimsonR in frame with EGFP and the...Viviana Gradinaru 100798-AAV1 pAAV-syn-FLEX-splitTVA-EGFP-tTA helper virus for monosynaptic tracing; to be...tracing; to be coinjected with pAAV-syn-FLEX-splitTVA-EGFP-tTA Ian Wickersham 104052-AAVPHP.V1 pAAV-CAG-DIO-EYFP...Edward Boyden 108422-AAV5 pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 AAV production plasmid encoding for Archon1 ...

  3. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...pyogenes Chen pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR...pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145 Mammalian hU6 yes, cut (enhanced) S. pyogenes EGFP Zou pRS416gT-GalL-Cas9...interfere, or nick. Selection , such as Puromycin or EGFP Cloning enzyme used for insertion of your gRNA sequence... Gen) 48140 Mammalian BbsI yes, nick S. pyogenes EGFP Zhang PX460 (3rd Gen) 48873 Mammalian BbsI yes, ...3rd Gen) 48138 Mammalian BbsI yes, cut S. pyogenes EGFP Zhang PX335 (2nd Gen) 42335 Mammalian BbsI yes, ... Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro U6 sgRNA BfuAI stuffer 50920 Mammalian...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR 60231 Mammalian/AAV SapI none...

  4. Validated gRNA Sequences

    Type
    Collection
    ...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria...23792628 Joung EGFP A. victoria GGAGCGCACCATCTTCTTCA 51763 cut S. pyogenes 24336571 Zhang EGFP A. victoria...24336571 Zhang EGFP A. victoria GGCGAGGGCGATGCCACCTA 61051 cut S. pyogenes 24179142 Del Bene EGFP A. victoria...23918387 Chen EGFP A. victoria GGGCACGGGCAGCTTGCCGG 47511 cut S. pyogenes 23792628 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GGTGAACCGCATCGAGCTGA 51765 cut S. pyogenes 24336571 Zhang EGFP A. victoria...GGTGGTGCAGATGAACTTCA 47513 cut S. pyogenes 23792628 Joung EGFP A. victoria TGAAGAAGATGGTGCGCTC 58255 cut S. pyogenes...

  5. Zhang Lab CRISPR Page

    Type
    Collection
    ... recombinase-2A-EGFP-KASH 60231 : sgRNA cloning backbone with Cre recombinase-2A-EGFP-KASH Detailed backbone...recombinase-2A-EGFP-KASH and an sgRNA. #60231 - AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR...efficiency. SpCas9 and SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A ...SpCas9 and single guide RNA 48138 : PX458; SpCas9-2A-EGFP and single guide RNA 62988 : PX459; SpCas9-2A-Puro...) and single guide RNA 48140 : PX461; SpCas9n-2A-EGFP (D10A nickase) and single guide RNA 62987 : PX462...20bp). #60230 - AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid enables Cre/loxP...contains two expression cassettes, Cre recombinase-2A-EGFP-KASH and an sgRNA backbone for cloning new targeted...

  7. Serotype Testing AAV

    Type
    Collection
    ... available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype testing... 37825-AAVrg.T 20 µL $ 140 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For...

  8. Lentiviral Prep Service

    Type
    Collection
    ...analysis of clonal dynamics. This library expresses EGFP for easy visualization via direct fluorescence. ... Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV promoter, Hygro Campeau Viral...

  9. Tetracycline Inducible Expression

    Type
    Collection
    ...16542 pBI-MCS-EGFP Expression of your gene of interest (MCS with a β-globin poly A) & EGFP from a bidirectional...pTet-IRES-EGFP Lentiviral plasmid for inducible expression of transgene of interest and EGFP None Either...pMA2640 Retroviral; CMV-driven; linked via IRES to EGFP-Blasticidin fusion; pMA2641 has rtTA driven by retroviral...

  10. CRISPR Plasmids - Tagging

    Type
    Collection
    ...PITCh system plasmids for CRISPR-based knock-in of EGFP-2A-PuroR cassette to the C-terminus of endogenous...the donor vector. The PITCh donor plasmid with an EGFP-2A-PuroR cassette, flanked by microhomologous sequences...first deposited PITCh plasmids were tested by fusing EGFP-2A-PuroR cassette to a nucleolar protein, fibrillarin... gRNA pCRIS-PITChv2-FBL - PITCh donor vector for EGFP-2A-PuroR knock-in into human FBL locus Jorgensen... the donor plasmids containing homology arms and EGFP are available at Addgene. Do you have suggestions...

  12. Biosensor AAV Preps

    Type
    Collection
    ...HaloCaMP1a 138327 pAAV-synapsin-HaloCaMP1a-EGFP Syn HaloCaMP1a EGFP Constitutive 1, 9 Schreiter Calcium Sensor...HaloCaMP1b 138328 pAAV-synapsin-HaloCaMP1b-EGFP Syn HaloCaMP1b EGFP Constitutive 1, 9 Schreiter Dopamine Sensors...Archon 108422 pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 CAG Archon1 EGFP Cre dependent 5 Boyden 115892 pAAV-Syn-Archon1...Archon1 EGFP Constitutive 8 Boyden 115893 pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] Syn Archon1 EGFP Cre dependent...

  13. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...blue fluorescent protein 35S-eGFP-nosT - Transient expression vector for eGFP in plants Find FP tagging ...Lentiviral shRNA expression pLJM1-EGFP - 3rd gen lentiviral vector for EGFP fusion; PGK driven puromycin Hygromycin...Expresses mCherry tag in mammalian cells pBI-MCS-EGFP - Tet-inducible Find more Tet-inducible empty backbones...proteins (GFP, mCherry, etc) Localization pcDNA3-EGFP - C-terminal GFP for mammalian expression pLV-mCherry...

  15. AAV Molecular Tools

    Type
    Collection
    ... Serotype PI 98747 pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a 5, rg* ...expression of cytoplasmic tdTomato and synaptophysin-EGFP for labeling of axon terminals. 1 Zeng 71760 pAAV...Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent expression...

  17. Recombinases AAV Preps

    Type
    Collection
    ...2, 5, 8, 9, rh10 Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre...EBFP-Cre Syn EBFP 5 Zeng 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn eGFP 1, 2, 5, 8, 9, rg*, PHPeB Wilson...

  18. AAV for Neuronal Tracing

    Type
    Collection
    ...Description Serotype PI 52473 pAAV-synP-FLEX-splitTVA-EGFP-B19G Can be used to complement deletion-mutant rabies...virus AAV1 Wickersham 100798 pAAV-syn-FLEX-splitTVA-EGFP-tTA These AAV together can be used to complement...

  19. Optogenetics AAV Preps

    Type
    Collection
    ...dependent 1, 5 Yizhar 198513 pAAV_hSyn-PdCO-EGFP-WPRE Syn PdCO EGFP Constitutive 1, 5 Yizhar 198516 pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE...pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE Syn PdCO, ChrimsonR (soma-targeted) EGFP Cre dependent 1, 5 ...

  20. Retrovirus Plasmids

    Type
    Collection
    ...screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression plasmid...of dsRed and the activation of your gene fused to eGFP expression Clevers 18760 MSCV IRES Luciferase MSCV...
Showing: 61 - 80 of 100 results