Skip to main content

We narrowed to 100 results for: EGFP

Showing: 61 - 80 of 100 results
  1. Brain Initiative Collection

    Type
    Collection
    ...198513-AAV1 pAAV_hSyn-PdCO-EGFP-WPRE Expresses optimized PdCO in frame with EGFP under control of human synapsin1...198513-AAV5 pAAV_hSyn-PdCO-EGFP-WPRE Expresses optimized PdCO in frame with EGFP under control of human synapsin1...pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE Expresses bicistronically soma-targeted ChrimsonR in frame with EGFP and the...Viviana Gradinaru 100798-AAV1 pAAV-syn-FLEX-splitTVA-EGFP-tTA helper virus for monosynaptic tracing; to be...tracing; to be coinjected with pAAV-syn-FLEX-splitTVA-EGFP-tTA Ian Wickersham 104052-AAVPHP.V1 pAAV-CAG-DIO-EYFP...Edward Boyden 108422-AAV5 pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 AAV production plasmid encoding for Archon1 ...
  2. Brain Armamentarium

    Type
    Collection
    ...pAAV-AiE0873m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN5140) Expression of CoChR-EGFP in striatal cholinergic...pAAV-AiE0452h_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN4035) Expression of CoChR-EGFP in striatal indirect pathway...pAAV-AiE0779m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN4033) Expression of CoChR-EGFP in striatal direct pathway...Tasic Melina Fan 221463-AAV1 pAAV_BiPVe4_eGFP AAV construct expressing eGFP driven by chandelier cell-targeting...construct expressing eGFP driven by chandelier cell-targeting enhancer. Alias: pAAV_WDC0004_eGFP Gordon Fishell...enhancer. Alias: pAAV_WDC0004_eGFP Gordon Fishell James M. Wilson 221463-PHPeB pAAV_BiPVe4_eGFP AAV construct...
  3. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...pyogenes Chen pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR...pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145 Mammalian hU6 yes, cut (enhanced) S. pyogenes EGFP Zou pRS416gT-GalL-Cas9...interfere, or nick. Selection , such as Puromycin or EGFP Cloning enzyme used for insertion of your gRNA sequence... Gen) 48140 Mammalian BbsI yes, nick S. pyogenes EGFP Zhang PX460 (3rd Gen) 48873 Mammalian BbsI yes, ...3rd Gen) 48138 Mammalian BbsI yes, cut S. pyogenes EGFP Zhang PX335 (2nd Gen) 42335 Mammalian BbsI yes, ... Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro U6 sgRNA BfuAI stuffer 50920 Mammalian...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR 60231 Mammalian/AAV SapI none...
  4. Validated gRNA Sequences

    Type
    Collection
    ...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria...23792628 Joung EGFP A. victoria GGAGCGCACCATCTTCTTCA 51763 cut S. pyogenes 24336571 Zhang EGFP A. victoria...24336571 Zhang EGFP A. victoria GGCGAGGGCGATGCCACCTA 61051 cut S. pyogenes 24179142 Del Bene EGFP A. victoria...23918387 Chen EGFP A. victoria GGGCACGGGCAGCTTGCCGG 47511 cut S. pyogenes 23792628 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GGTGAACCGCATCGAGCTGA 51765 cut S. pyogenes 24336571 Zhang EGFP A. victoria...GGTGGTGCAGATGAACTTCA 47513 cut S. pyogenes 23792628 Joung EGFP A. victoria TGAAGAAGATGGTGCGCTC 58255 cut S. pyogenes...
  5. Tetracycline Inducible Expression

    Type
    Collection
    ...pTet-IRES-EGFP Lentiviral plasmid for Tet-controlled expression of transgene of interest with EGFP (On or...Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS Xiaojun Lian 171123 pLVX-TetOne-Puro-GFP...Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS Jason Sheltzer 11651 pLVUT-tTR-KRAB... Off) None TRE, miniCMV Maria Lung 16542 pBI-MCS-EGFP Bidirectional promoter (Pbi) for Tet-responsive ...expression (On or Off) of both your gene of interest and EGFP. Pbi contains a TRE between two minimal CMV promoters...Retroviral Tet-On vector for CMV-driven rtTA with EGFP and Blasticidin selection rtTA-Advanced Mikhail ...TLCV2 Lentiviral vector for tet-inducible Cas9-2A-EGFP expression. Based on LentiCRISPR v2 . Adam Karpf...
  6. Zhang Lab CRISPR Page

    Type
    Collection
    ... recombinase-2A-EGFP-KASH 60231 : sgRNA cloning backbone with Cre recombinase-2A-EGFP-KASH Detailed backbone...recombinase-2A-EGFP-KASH and an sgRNA. #60231 - AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR...efficiency. SpCas9 and SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A ...SpCas9 and single guide RNA 48138 : PX458; SpCas9-2A-EGFP and single guide RNA 62988 : PX459; SpCas9-2A-Puro...) and single guide RNA 48140 : PX461; SpCas9n-2A-EGFP (D10A nickase) and single guide RNA 62987 : PX462...20bp). #60230 - AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid enables Cre/loxP...contains two expression cassettes, Cre recombinase-2A-EGFP-KASH and an sgRNA backbone for cloning new targeted...
  7. Fluorescent Proteins: FRET

    Type
    Collection
    ...-sREACh-N3 EGFP ShadowY** 488 0.6 531** 136,000 0.01 6.1 4.5 mEGFP-N1 , CMV-ShadowY , EGFP-ShadowY λ Dex...mTFP1-N1 , mCitrine-pBAD EGFP mCherry 488 0.60 610 72,000 0.22 5.3 1.9 mEGFP-N1 , mCherry2-N1 , pcDNA3.1...sReach-mTurquoise2 EGFP sREACh** (super-REACh, aka Nữ) 488 0.60 531** 115,000 0.07 6.0 4.1 mEGFP-N1 , sREACh-...pcDNA3.1 CMV mCherry-eGFP BGH Clover mRuby2 505 0.76 600 113,000 0.38 6.3 4.5 pcDNA3-Clover , pcDNA3-mRuby2...
  8. Lentiviral Prep Service

    Type
    Collection
    ...analysis of clonal dynamics. This library expresses EGFP for easy visualization via direct fluorescence. ... Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV promoter, Hygro Campeau Viral...
  9. Serotype Testing AAV

    Type
    Collection
    ... available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype testing... 37825-AAVrg.T 20 µL $ 150 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For...
  10. CRISPR Plasmids - Tagging

    Type
    Collection
    ...PITCh system plasmids for CRISPR-based knock-in of EGFP-2A-PuroR cassette to the C-terminus of endogenous...the donor vector. The PITCh donor plasmid with an EGFP-2A-PuroR cassette, flanked by microhomologous sequences...first deposited PITCh plasmids were tested by fusing EGFP-2A-PuroR cassette to a nucleolar protein, fibrillarin... gRNA pCRIS-PITChv2-FBL - PITCh donor vector for EGFP-2A-PuroR knock-in into human FBL locus Jorgensen... the donor plasmids containing homology arms and EGFP are available at Addgene. Do you have suggestions...
  11. Biosensor AAV Preps

    Type
    Collection
    ...HaloCaMP1a 138327 pAAV-synapsin-HaloCaMP1a-EGFP Syn HaloCaMP1a EGFP Constitutive 1, 9 Schreiter Calcium Sensor...HaloCaMP1b 138328 pAAV-synapsin-HaloCaMP1b-EGFP Syn HaloCaMP1b EGFP Constitutive 1, 9 Schreiter Dopamine Sensors...Archon 108422 pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 CAG Archon1 EGFP Cre dependent 5 Boyden 115892 pAAV-Syn-Archon1...Archon1 EGFP Constitutive 8 Boyden 115893 pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] Syn Archon1 EGFP Cre dependent...
  12. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...blue fluorescent protein 35S-eGFP-nosT - Transient expression vector for eGFP in plants Find FP tagging ...Lentiviral shRNA expression pLJM1-EGFP - 3rd gen lentiviral vector for EGFP fusion; PGK driven puromycin Hygromycin...Expresses mCherry tag in mammalian cells pBI-MCS-EGFP - Tet-inducible Find more Tet-inducible empty backbones...proteins (GFP, mCherry, etc) Localization pcDNA3-EGFP - C-terminal GFP for mammalian expression pLV-mCherry...
  13. AAV for Neuronal Tracing

    Type
    Collection
    ...Description Serotype PI 52473 pAAV-synP-FLEX-splitTVA-EGFP-B19G Can be used to complement deletion-mutant rabies...AAV1 Ian Wickersham 100798 pAAV-syn-FLEX-splitTVA-EGFP-tTA These AAV together can be used to complement...
  14. Recombinases AAV Preps

    Type
    Collection
    ...9, rh10 James M. Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 James M. Wilson 55632...Syn EBFP 5 Hongkui Zeng 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn eGFP 1, 2, 5, 8, 9, rg*, PHPeB James...
Showing: 61 - 80 of 100 results