Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 61 - 80 of 101 results

  1. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...pyogenes Chen pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR...pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145 Mammalian hU6 yes, cut (enhanced) S. pyogenes EGFP Zou pRS416gT-GalL-Cas9...interfere, or nick. Selection , such as Puromycin or EGFP Cloning enzyme used for insertion of your gRNA sequence... Gen) 48140 Mammalian BbsI yes, nick S. pyogenes EGFP Zhang PX460 (3rd Gen) 48873 Mammalian BbsI yes, ...3rd Gen) 48138 Mammalian BbsI yes, cut S. pyogenes EGFP Zhang PX335 (2nd Gen) 42335 Mammalian BbsI yes, ... Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro U6 sgRNA BfuAI stuffer 50920 Mammalian...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR 60231 Mammalian/AAV SapI none...

  2. Validated gRNA Sequences

    Type
    Collection
    ...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria...23792628 Joung EGFP A. victoria GGAGCGCACCATCTTCTTCA 51763 cut S. pyogenes 24336571 Zhang EGFP A. victoria...24336571 Zhang EGFP A. victoria GGCGAGGGCGATGCCACCTA 61051 cut S. pyogenes 24179142 Del Bene EGFP A. victoria...23918387 Chen EGFP A. victoria GGGCACGGGCAGCTTGCCGG 47511 cut S. pyogenes 23792628 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GGTGAACCGCATCGAGCTGA 51765 cut S. pyogenes 24336571 Zhang EGFP A. victoria...GGTGGTGCAGATGAACTTCA 47513 cut S. pyogenes 23792628 Joung EGFP A. victoria TGAAGAAGATGGTGCGCTC 58255 cut S. pyogenes...

  3. Zhang Lab CRISPR Page

    Type
    Collection
    ... recombinase-2A-EGFP-KASH 60231 : sgRNA cloning backbone with Cre recombinase-2A-EGFP-KASH Detailed backbone...recombinase-2A-EGFP-KASH and an sgRNA. #60231 - AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR...efficiency. SpCas9 and SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A ...SpCas9 and single guide RNA 48138 : PX458; SpCas9-2A-EGFP and single guide RNA 62988 : PX459; SpCas9-2A-Puro...) and single guide RNA 48140 : PX461; SpCas9n-2A-EGFP (D10A nickase) and single guide RNA 62987 : PX462...20bp). #60230 - AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid enables Cre/loxP...contains two expression cassettes, Cre recombinase-2A-EGFP-KASH and an sgRNA backbone for cloning new targeted...

  4. Serotype Testing AAV

    Type
    Collection
    ... available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype testing... 37825-AAVrg.T 20 µL $ 140 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For...

  5. Qi Lab CRISPR Page

    Type
    Collection
    ...pSLQ1658-dCas9-EGFP Human expression vector containing dCas9 that is fused to 2x NLS and EGFP for CRISPR ...targeting endogenous CD71 gene 46919 pMLS-SV40-EGFP Target EGFP gene that is stably integrated into HEK293...

  6. Caltech Systemic Capsids

    Type
    Collection
    ...105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Control Wilson 105547 pENN.AAV.EF1a.eGFP.WPRE.rBG EF1a EGFP Control...CAG GFP Control Boyden 50469 pAAV-CaMKIIa-EGFP CamKIIa EGFP Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato...Dimidschstein Recombinases 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn Cre-EGFP expression Cre Wilson 105550...

  8. Tetracycline Inducible Expression

    Type
    Collection
    ...16542 pBI-MCS-EGFP Expression of your gene of interest (MCS with a β-globin poly A) & EGFP from a bidirectional...pTet-IRES-EGFP Lentiviral plasmid for inducible expression of transgene of interest and EGFP None Either...pMA2640 Retroviral; CMV-driven; linked via IRES to EGFP-Blasticidin fusion; pMA2641 has rtTA driven by retroviral...

  9. CRISPR Plasmids - Tagging

    Type
    Collection
    ...PITCh system plasmids for CRISPR-based knock-in of EGFP-2A-PuroR cassette to the C-terminus of endogenous...the donor vector. The PITCh donor plasmid with an EGFP-2A-PuroR cassette, flanked by microhomologous sequences...first deposited PITCh plasmids were tested by fusing EGFP-2A-PuroR cassette to a nucleolar protein, fibrillarin... gRNA pCRIS-PITChv2-FBL - PITCh donor vector for EGFP-2A-PuroR knock-in into human FBL locus Jorgensen... the donor plasmids containing homology arms and EGFP are available at Addgene. Do you have suggestions...

  11. Lentiviral Prep Service

    Type
    Collection
    ...analysis of clonal dynamics. This library expresses EGFP for easy visualization via direct fluorescence. ... Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV promoter, Hygro Campeau COVID...

  12. Biosensor AAV Preps

    Type
    Collection
    ...HaloCaMP1a 138327 pAAV-synapsin-HaloCaMP1a-EGFP Syn HaloCaMP1a EGFP Constitutive 1, 9 Schreiter Calcium Sensor...HaloCaMP1b 138328 pAAV-synapsin-HaloCaMP1b-EGFP Syn HaloCaMP1b EGFP Constitutive 1, 9 Schreiter Dopamine Sensors...Archon 108422 pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 CAG Archon1 EGFP Cre dependent 5 Boyden 115892 pAAV-Syn-Archon1...Archon1 EGFP Constitutive 8 Boyden 115893 pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] Syn Archon1 EGFP Cre dependent...

  13. AAV Molecular Tools

    Type
    Collection
    ... Serotype PI 98747 pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a 5, rg* ...expression of cytoplasmic tdTomato and synaptophysin-EGFP for labeling of axon terminals. 1 Zeng 71760 pAAV...Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent expression...

  15. Mammalian RNAi Tools

    Type
    Collection
    ...Expresses shRNA under the mouse U6 promoter; A CMV-EGFP reporter cassette is included in the vector to monitor...Plasmid Description PI 11578 pSico Cre addition causes EGFP to be recombined out of the construct, activating...Tyler Jacks 11579 pSicoR Cre addition causes both EGFP and shRNA to be recombined out of the construct,...

  16. Recombinases AAV Preps

    Type
    Collection
    ... 6.2, 8, 9, rh10 Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson EF1a Promoter...EBFP-Cre Syn EBFP 5 Zeng 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn eGFP 1, 5, 8, 9, rg*, PHPeB Wilson...

  17. AAV for Neuronal Tracing

    Type
    Collection
    ...Description Serotype PI 52473 pAAV-synP-FLEX-splitTVA-EGFP-B19G Can be used to complement deletion-mutant rabies...virus AAV1 Wickersham 100798 pAAV-syn-FLEX-splitTVA-EGFP-tTA These AAV together can be used to complement...

  20. Retrovirus Plasmids

    Type
    Collection
    ...screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression plasmid...of dsRed and the activation of your gene fused to eGFP expression Clevers 18760 MSCV IRES Luciferase MSCV...
Showing: 61 - 80 of 101 results