... pEMS1301 cre/EGFP/NLS N/A pEMS1308 EGFP/cre N/A pEMS1302 EGFP/cre/NLS N/A pEMS1306 EGFP/NLS N/A pEMS1307...pEMS1153 EGFP/NLS Ple37 CRH pEMS1154 EGFP/NLS Ple38 CRH pEMS1155 EGFP/NLS Ple39 CRH pEMS1156 EGFP/NLS Ple44...pEMS1113 EGFP/cre/NLS Ple51 DBH pEMS1362 EGFP/NLS Ple52 DCX pEMS1198 EGFP/NLS Ple53 DCX pEMS1199 EGFP/NLS ...pEMS1167 EGFP/NLS Ple63 DRD1 pEMS1168 EGFP/NLS Ple64 FEV pEMS1129 EGFP/cre/NLS Ple64 FEV pEMS1398 EGFP/NLS ...pEMS1160 EGFP/NLS Ple93 GPR88 pEMS1161 EGFP/NLS Ple94 GPR88 pEMS1162 EGFP/NLS Ple95 GPR88 pEMS1163 EGFP/NLS...pEMS1216 EGFP/NLS Ple99 GRP pEMS1371 EGFP/NLS Ple100 GRP pEMS1372 EGFP/NLS Ple101 GRP pEMS1373 EGFP/NLS Ple102...pEMS1171 EGFP/NLS Ple151 OLIG1 pEMS1172 EGFP/NLS Ple152 OXT pEMS1237 EGFP/NLS Ple153 OXT pEMS1238 EGFP/NLS ...

...Half-Site eGFP-TALEN-01-Left TAL2000 TCGCCACCAT eGFP-TALEN-01-Right TAL2001 TGAACAGCTC eGFP-TALEN-02-Left...TGGTGCCCAT eGFP-TALEN-02-Right TAL2003 TTACGTCGCC eGFP-TALEN-03-Left TAL2004 TCTGCACCAC eGFP-TALEN-03-Right...TGGGCCAGGG eGFP-TALEN-04-Left TAL2006 TGGAGTACAA eGFP-TALEN-04-Right TAL2007 TGATATAGAC eGFP-TALEN-05-Left...TTCAGCGTGTC eGFP-TALEN-05-Right TAL2009 TAGGTGGCATC eGFP-TALEN-06-Left TAL2010 TGCCACCTACG eGFP-TALEN-06-...TGCAGATGAAC eGFP-TALEN-07-Left TAL2012 TGGCCCACCCT eGFP-TALEN-07-Right TAL2013 TGCACGCCGTA eGFP-TALEN-08-...TTCAAGATCCG eGFP-TALEN-08-Right TAL2015 TGCACGCTGCC eGFP-TALEN-09-Left TAL2016 TAGAGGATCCAC eGFP-TALEN-09...TCGCCCTTGCTC eGFP-TALEN-10-Left TAL2018 TCCGGCGAGGGC eGFP-TALEN-10-Right TAL2019 TCAGCTTGCCGT eGFP-TALEN-11...

...pAAV-hSyn-EGFP hSyn EGFP Constitutive 1, 2, 5, 8, 9, rg* Roth 50469 pAAV-CaMKIIa-EGFP CaMKIIa EGFP Constitutive...-FLEX-EGFP-WPRE CAG EGFP Cre dependent 1, 2, 5, 8, 9, rg* Zeng 59331 pAAV-CAG-FLEX-EGFP CAG EGFP Cre dependent...pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP EF1a NLS-mCherry or nls-EGFP Cre dependent 1, 2, 5, 8, 9, rg* Harvey...-dependent 1 Deisseroth 50457 pAAV-hSyn-DIO-EGFP hSyn EGFP Cre dependent 1, 2, 5, 8, rg* Roth 50459 pAAV-hSyn-DIO-mCherry...pENN.AAV.CamKII0.4.eGFP.WPRE.rBG CamKII EGFP Constitutive 1, 5, 9 Wilson 105535 pAAV.TBG.PI.eGFP.WPRE.bGH TBG EGFP... PHP.eB Gradinaru 100896 pAAV.GFA104.PI.eGFP.WPRE.bGH GFA104 EGFP Constitutive 5 Haydon 104055 pAAV-CAG-eYFP...Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive 1, 2, 5, 8, 9, rh10,...

...Gadella 58473 pEGFP-C1 F-tractin-EGFP Actin Filaments F-tractin EGFP Dyche Mullins 41147 pEGFP Centrin2 Centrioles... LC3 EGFP Tamotsu Yoshimori 21073 pEGFP-LC3 Autophagosome LC3 EGFP Tamotsu Yoshimori 24920 pEGFP-LC3 (...Cortactin EGFP Anna Huttenlocher 32907 pEGFP-rNFM Intermediate Filaments (neuronal) Nefm EGFP Anthony Brown...Centrin-2 EGFP Erich Nigg 41151 pEGFP Cep170 C-term Centrioles (dependent on cell cycle) Cep170 EGFP Erich... from GAP43 EGFP Connie Cepko 61099 Lck-GFP Membrane Palmitoylation sequence from Lck EGFP Steven Green...Takemaru 89770 pLenti-EGFP-hChibby1 Mother Centrioles / Ciliary Base Chibby1 EGFP Ken-Ichi Takemaru 118084...118084 pLenti-EB1-EGFP Microtubules EB1 EGFP Ken-Ichi Takemaru 122871 GFP-hCCDC11 Centriolar satellites...

...5HT3HC CAG IRES-EGFP No Sternson 119739 pCAG PSAM4 GlyR IRES EGFP PSAM4-GlyR CAG IRES-EGFP No Sternson 119740...HC IRES EGFP PSAM4-5HT3 HC CAG IRES-EGFP No Sternson 119741 AAV SYN flex PSAM4 GlyR IRES EGFP PSAM4-GlyR...GlyR Syn IRES-EGFP Yes Sternson 119742 AAV SYN PSAM4 GlyR IRES EGFP PSAM4-GlyR Syn IRES-EGFP No Sternson...IRES-EGFP Yes Sternson 32480 CAG::PSAML141F,Y115F:GlyR-IRES-GFP PSAML141F,Y115F-GlyR CAG IRES-EGFP No Sternson... Syn IRES-EGFP Yes Sternson 32478 CAG::PSAML141F:GlyR-IRES-GFP PSAML141F-GlyR CAG IRES-EGFP Yes Sternson... 119744 AAV CAMKII PSAM4 GlyR IRES EGFP PSAM4-GlyR CamKII IRES-EGFP No Sternson 196041 pAAV Syn intron.../Fusion mCherry IRES-mCitrine tdTomato ChR2 IRES-EGFP Recombinase Cre-dependent Flp-dependent Plasmid ...

...Plasmid 47511 pFYF1320 EGFP Site#1 47512 pFYF1320 EGFP Site#2 47513 pFYF1320 EGFP Site#3... CRISPR Joung Lab CRISPR Plasmids EGFP gRNA CRISPR-Cas/RGN expression plasmids for EGFP You may... for EGFP CRISPR...technology to modify three different sites in the EGFP reporter gene (Fu et al., Nat Biotechnol. 2013)....

...expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...other versions of pULTRA. Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895...plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid...14748 pLKO.3G 3rd U6-driven shRNA empty plasmid with EGFP marker. See plasmid 14749 for Thy1.1 selection. ...puro resistance Sabatini 14883 FUGW 3rd hUbC-driven EGFP; can be used for cDNA expression Baltimore 12247...3rd Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression...added; Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression...

...IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP none 5 Sternson 119744 AAV CAMKII PSAM4 GlyR IRES EGFP PSAM4...119741 AAV SYN flex PSAM4 GlyR IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP Cre-dependent 5, 9 Sternson 119742... Fusion tags mCherry HA Non-fusion tags mCitrine EGFP dTomato Activity Cre-dependent Flp-dependent Cre...PSAM4 GlyR - Inhibition IRES EGFP none 5 Sternson 121538 pAAV SYN1 HA-hM4D(Gi) hM4D(Gi) - Inhibition HA ...

...AAV pCAG-FLEX-EGFP-WPRE CAG EGFP, Cre-dependent Control Zeng 50465 pAAV-hSyn-EGFP Syn EGFP Control Roth...Roth 50469 pAAV-CaMKIIa-EGFP CamKII EGFP Control Roth 114472 pAAV-hSyn-mCherry Syn mCherry Control Deisseroth...tdTomato Control Boyden 50457 pAAV-hSyn-DIO-EGFP Syn EGFP, Cre-dependent Control Roth 55650 pAAV-hSyn ...Syn EYFP Control Gradinaru 105547 pENN.AAV.EF1a.eGFP.WPRE.rBG EF1a EGFP Control Wilson Recombinases 24593...Recombinases Deisseroth 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn EGFP-tagged Cre expression Recombinases...Gradinaru 112677 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP EF1a Color-flipping switch. Expresses NLS-mCherry...NLS-mCherry in the absence of Cre, and expresses NLS-EGFP in Cre-positive cells. Control Harvey 137164 pAAV-nEF-Con...

...EF1alpha-EGFPcre Cre-EGFP fusion EF-1 alpha Mammalian Sauer 11955 pBS505 EF1alpha-EGFPcre* Cre-EGFP fusion...sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR Cre, KASH-tagged EGFP, and sgRNA expression hSyn...Retroviral Luikart 67503 pF CAG luc-EGFP-cre puro Luciferase - EGFP- Cre fusion CAG Mammalian Stringer ...pCL20c-MSCV-IRES-CRE Cre MSCV Mammalian Roussel 86805 pLV-EGFP-Cre EGFP-Cre fusion CMV Lentiviral Lasek 87682 AAV-U6gRNA1...15037 also contains IRES-EGFP Mammalian Costantini 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE Cre activates...GFP expression Mammalian Cepko 8389 p212 pCMV-EGFP/RFP EGFP-dsRed gene switch plasmid Mammalian Green 22799...DsRED and EGFP Cre recombinase reporter Lentiviral Geijsen 65726 pLV-CMV-LoxP-DsRed-LoxP-eGFP Switches ...

...pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1 SOD1 H1 ALS Patrick Aebischer 10881 pCCL cPPT PGK EGFP WPRE LTR H1...14121 pcDNA3-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP...Dantuma 23971 VCP(wt)-EGFP VCP His, GFP, HA CMV ALS Nico Dantuma 23972 VCP(R155H)-EGFP VCP His, GFP, HA CMV...Dantuma 23973 VCP(A232E)-EGFP VCP His, GFP, HA CMV ALS Nico Dantuma 23974 VCP(DK0)-EGFP VCP His, GFP, HA CMV...Merrifield 28195 tdp43-EGFP construct2 TARDBP GFP CMV ALS Zuoshang Xu 28196 tdp43-EGFP construct3 TARDBP GFP...Zuoshang Xu 28197 tdp43-EGFP construct4 TARDBP GFP CMV ALS Zuoshang Xu 28198 tdp43-EGFP construct5 TARDBP GFP...Zuoshang Xu 28199 tdp43-EGFP construct6 TARDBP GFP CMV ALS Zuoshang Xu 28200 tdp43-EGFP construct7 TARDBP GFP...

...pyogenes Chen pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR...pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145 Mammalian hU6 yes, cut (enhanced) S. pyogenes EGFP Zou pRS416gT-GalL-Cas9...interfere, or nick. Selection , such as Puromycin or EGFP Cloning enzyme used for insertion of your gRNA sequence... Gen) 48140 Mammalian BbsI yes, nick S. pyogenes EGFP Zhang PX460 (3rd Gen) 48873 Mammalian BbsI yes, ...3rd Gen) 48138 Mammalian BbsI yes, cut S. pyogenes EGFP Zhang PX335 (2nd Gen) 42335 Mammalian BbsI yes, ... Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro U6 sgRNA BfuAI stuffer 50920 Mammalian...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR 60231 Mammalian/AAV SapI none...

...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria...23792628 Joung EGFP A. victoria GGAGCGCACCATCTTCTTCA 51763 cut S. pyogenes 24336571 Zhang EGFP A. victoria...24336571 Zhang EGFP A. victoria GGCGAGGGCGATGCCACCTA 61051 cut S. pyogenes 24179142 Del Bene EGFP A. victoria...23918387 Chen EGFP A. victoria GGGCACGGGCAGCTTGCCGG 47511 cut S. pyogenes 23792628 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GGTGAACCGCATCGAGCTGA 51765 cut S. pyogenes 24336571 Zhang EGFP A. victoria...GGTGGTGCAGATGAACTTCA 47513 cut S. pyogenes 23792628 Joung EGFP A. victoria TGAAGAAGATGGTGCGCTC 58255 cut S. pyogenes...

... available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype testing... 37825-AAVrg.T 20 µL $ 140 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For...

... recombinase-2A-EGFP-KASH 60231 : sgRNA cloning backbone with Cre recombinase-2A-EGFP-KASH Detailed backbone...recombinase-2A-EGFP-KASH and an sgRNA. #60231 - AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR...efficiency. SpCas9 and SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A ...SpCas9 and single guide RNA 48138 : PX458; SpCas9-2A-EGFP and single guide RNA 62988 : PX459; SpCas9-2A-Puro...) and single guide RNA 48140 : PX461; SpCas9n-2A-EGFP (D10A nickase) and single guide RNA 62987 : PX462...20bp). #60230 - AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid enables Cre/loxP...contains two expression cassettes, Cre recombinase-2A-EGFP-KASH and an sgRNA backbone for cloning new targeted...

...pSLQ1658-dCas9-EGFP Human expression vector containing dCas9 that is fused to 2x NLS and EGFP for CRISPR ...targeting endogenous CD71 gene 46919 pMLS-SV40-EGFP Target EGFP gene that is stably integrated into HEK293...

...105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Control Wilson 105547 pENN.AAV.EF1a.eGFP.WPRE.rBG EF1a EGFP Control...CAG GFP Control Boyden 50469 pAAV-CaMKIIa-EGFP CamKIIa EGFP Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato...Dimidschstein Recombinases 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn Cre-EGFP expression Cre Wilson 105550...

...16542 pBI-MCS-EGFP Expression of your gene of interest (MCS with a β-globin poly A) & EGFP from a bidirectional...pTet-IRES-EGFP Lentiviral plasmid for inducible expression of transgene of interest and EGFP None Either...pMA2640 Retroviral; CMV-driven; linked via IRES to EGFP-Blasticidin fusion; pMA2641 has rtTA driven by retroviral...

...PITCh system plasmids for CRISPR-based knock-in of EGFP-2A-PuroR cassette to the C-terminus of endogenous...the donor vector. The PITCh donor plasmid with an EGFP-2A-PuroR cassette, flanked by microhomologous sequences...first deposited PITCh plasmids were tested by fusing EGFP-2A-PuroR cassette to a nucleolar protein, fibrillarin... gRNA pCRIS-PITChv2-FBL - PITCh donor vector for EGFP-2A-PuroR knock-in into human FBL locus Jorgensen... the donor plasmids containing homology arms and EGFP are available at Addgene. Do you have suggestions...

...analysis of clonal dynamics. This library expresses EGFP for easy visualization via direct fluorescence. ... Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV promoter, Hygro Campeau Return...