We narrowed to 81 results for: KAN
-
TypeBlog Post...proteins in the nervous system. Livet J, Weissman TA, Kang H, Draft RW, Bennis RA, Sanes JR, Lichtman JW. Nature...
-
CRISPR Plasmids - Tagging
TypeCollection... CRISPR/Cas Toolkit Kanemaki Lab Auxin-Inducible Degron Tagging Masato Kanemaki's lab has developed a ... -
Antibodies 101: Multiplex Immunofluorescence
TypeBlog Post...://doi.org/10.13070/mm.en.9.2846 Radtke, A. J., Kandov, E., Lowekamp, B., Speranza, E., Chu, C. J., Gola... -
Antibodies 101: Antibody Engineering and Directed Evolution
TypeBlog Post...23(9), 1126–1136. https://doi.org/10.1038/nbt1142 Kang, B. H., Lax, B. M., & Wittrup, K. D. (2022). Yeast... -
Mycoplasma Contamination: Where Does It Come From and How to Prevent It
TypeBlog Post...1510 . https://doi.org/10.3390/cells8121510 Sung H, Kang SH, Bae YJ, Hong JT, Chung YB, Lee CK, Song S (2006... -
A Practical Guide to Optimizing AAV DIO and FLEx Vector Expression
TypeBlog Post...K, Sanders E, Tasissa M, Kostman M, Tillgren M, Makana Hanley L, Mueller I, Mitsopoulos A, Fan M (2020... -
Typing CRISPR Systems
TypeBlog Post...https://doi.org/10.1038/nature24049 Altae-Tran, H., Kannan, S., Suberski, A. J., Mears, K. S., Demircioglu... -
Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2: Reprogramming and Transdifferentiation
TypeBlog Post...25578634. PubMed Central PMCID: PMC4412587. 28. Mohsen-Kanson, T., et al., Differentiation of human induced pluripotent... -
CRISPR 101: Multiplex Expression of gRNAs
TypeBlog Post... ideal number. First you generate four unique kanamycin-resistant plasmids, each containing a different... -
Validated gRNA Sequences
TypeCollection...TATTAAATGCAGATAACCT 66089 cut S. pyogenes 25249454 Seydoux KANK3 H. sapiens GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes...GGGGCCACTAGGGACAGGAT 72833 cut S. pyogenes 27052166 Kanemaki mmp21 D. rerio CGGAGCTGATCACTGACA 72890 cut S.... -
Delivery Methods for Generating iPSCs
TypeBlog Post...Masayuki, Minoru Iijima, Manami Ohtaka, and Mahito Nakanishi. "Novel Strategy to Control Transgene Expression... -
Optogenetics + CRISPR, Using Light to Control Genome Editing
TypeBlog Post...-018-0178-9 Hemphill J, Borchardt EK, Brown K, Asokan A, Deiters A (2015) Optical Control of CRISPR/Cas9... -
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More
TypeBlog Post...carries a spacer targeting the gene of interest and kanamycin resistance E. coli carrying the phage recombineering... -
CRISPR Plasmids - Bacteria
TypeCollection...NGG) 42875 pCRISPR BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection...4215-4231. PMID: 26865709 Other citations include: Kanaan, et al. 2017. Rationally Engineered AAV Capsids... -
Fluorescent Proteins: FRET
TypeCollection...128,000 0.45 6.4 4.9 pNCS-mClover3 , pNCS-mRuby3 , pKanCMV-mClover3-mRuby3 mNeonGreen mRuby3 506 0.80 592 ... -
Rett Syndrome
TypeCollection... (Link opens in a new window) PMID: 6638958 Kankirawatana et al. 2006. Early progressive encephalopathy... -
Deisseroth INTRSECT Collection
TypeCollection...AC, Tepler S, Poulin JF, Ansorge M, Awatramani R, Kang UJ, Rayport S. 2018. Dopamine neuron glutamate cotransmission... -
Tetracycline Inducible Expression
TypeCollection...conditional auxin-inducible degron system Masato Kanemaki 92099 AAVS1_Puro_Tet3G_3xFLAG_Twin_Strep Tet-inducible... -
Molecular Biology Reference
TypeGuide...Ethanol) 25 µg/mL Hygromycin B 200 mg/mL 200 µg/mL Kanamycin 50 mg/mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg...