We narrowed to 86 results for: LucY
-
TypeBlog Post...stranded breaks (DSB) are lethal. Addgene depositor Luciano Marraffini’s lab took advantage of this lethality...
-
Promega Plasmid Collection
TypeCollection...HaloTag, SmBiT, LgBiT, HiBiT, and more. Luciferase Reporters Luciferase (Link opens in a new window) reporter...NanoLuc luciferase-fusion protein expressed in cells. Additional Resources Browse Addgene's Luciferase Plasmid...Find luciferase reporter vectors for sensitive gene expression analysis and fusion vectors containing...experimental workflows. The collection contains luciferase reporter vectors for sensitive gene expression..., reporter, protein, or tag, such as "NFAT", "luciferase", "Ras", "NanoLuc", "HaloTag", "BiT", or other... 19.1 kDa and exceptionally bright and stable luciferase that enables highly sensitive detection at endogenous...living cells. NanoBRET PPI assays use NanoLuc Luciferase as a BRET energy donor and HaloTag protein, labeled... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection... mCherry Luciferase Lentiviral dual reporter vector expressing mCherry and firefly luciferase to simultaneously...105621 Lenti-luciferase-P2A-Neo Lentiviral reporter vector expressing firefly luciferase with neomycin...firefly luciferase and ZsGreen. Alejandro Balazs 170674 pBOBI-FLuc Express firefly luciferase. Used in...David Nemazee 170575 pCMV-FLuc Express firefly luciferase. Used in MLV-based SARS-CoV-2 pseudovirus assay...-GFP-Luc Lentiviral vector expressing GFP and luciferase for use as a reporter in pseudovirus production... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection... genomic engineering Luciferase Reporter pGL3 Basic Vector - Firefly luciferase vector for investigating... to create a luciferase reporter Promoter Measure promoter strength pBV-Luc - Luciferase ...investigating regions controlling transcription See our Luciferase collection of plasmid backbones into which you...target genes can be inserted into this firefly luciferase reporter to test for their effects on protein... -
Zhang Lab CRISPR Page
TypeCollection...to LacZ, plus luciferase-2A-Cre recombinase 60226 : sgRNA cloning backbone with luciferase-2A-Cre recombinase...sgRNAs targeting KRAS , p53 , and LKB1 , plus luciferase-2A-Cre recombinase, and Kras G12D HDR template...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and sgRNAs targeting the mouse...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and an sgRNA targeted to LacZ...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and an sgRNA backbone for ... -
Penn Vector Core Partnership with Addgene
TypeCollection...James M. Wilson AV-1-PV0105 105532-AAV1 pAAV.CMV.ffLuciferase.SV40 Control James M. Wilson AV-1-PV1917 105541...James M. Wilson AV-8-PV0105 105532-AAV8 pAAV.CMV.ffLuciferase.SV40 Control James M. Wilson AV-8-PV0146 105535...Karl Deisseroth AV-5-PV0105 105532-AAV5 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-5-PV1090 105537-AAV5... M. Wilson AV-8-PV1302 105538-AAV8 pENN.AAV.TBG.PI.ffLuciferase.RBG James M. Wilson AV-8-PV3637 65015-...Karl Deisseroth AV-9-PV0105 105532-AAV9 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-9-PV0109 105533-AAV9...Karl Deisseroth AV-2-PV0105 105532-AAV2 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-1-PV3365 105554-AAV1... -
Chemogenetics Plasmids
TypeCollection...channelrhodopsin. When the luciferase enzyme oxidizes its substrate (luciferin), it generates light that...luminescent opsins: fusion proteins of a light-emitting luciferase and a light-sensing optogenetic element such ...neuron. LMO can be activated either by adding the luciferin substrate or by external illumination, making ... -
Bacterial Expression Systems
TypeCollection...transcription factors. Addgene Blog Luciferase Technologies Enabled by NanoLuc® Luciferase Fluorescent Biosensors ...easily measurable reporter genes (e.g., LacZ, luciferase, or fluorescent proteins) under the control of...FFluc Promoter activity Luminescence (firefly luciferase) Mycobacterium sp. Brian Robertson , Siouxsie... -
Retrovirus Plasmids
TypeCollection...Clevers 18760 MSCV IRES Luciferase MSCV Plasmid for transgene expression with luciferase expression. Scott ...Sun 60683 pLXIN-Luc MoMSV Stable expression of luciferase in mammalian cells. Alice Wong 83356 pMXs-3XHA-EGFP-OMP25... -
Chemogenetics Guide
TypeGuide...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin) is ...efficiencies. Depending on the type of luciferase used, the luciferin substrate may be the native coelenterazine...is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite or inhibit...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference... -
Fluorescent Proteins: FRET
TypeCollection...Read more about self-labeling tags on our blog . Luciferase can be paired with a fluorescent protein acceptor...Resonance Energy Transfer (BRET) . Browse Addgene's Luciferase Plasmid Collection or the Promega Plasmid Collection... -
COVID-19 Resources
TypeCollection...2020, scientists worked at lightning speed to elucidate as much as they could about this novel virus. ... pseudotyped virus. It also lists several luciferase and fluorescent reporter plasmids that have been... -
Control AAV Preps
TypeCollection... 5, 8 James M. Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase Constitutive 8 James M. Wilson... -
Lentivirus Plasmids
TypeCollection...pLentipuro3/TO/V5-GW/EGFP-Firefly Luciferase 3rd Expression of EGFP-Firefly luciferase fusion protein. Ethan Abel... -
Sequencing Primers
TypeGuide...AGTCAAGTAACAACCGCGA 3' end of luciferase Forward LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase Reverse M13 Forward...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC 5' of ... -
Molecular Biology Reference
TypeGuide...These plasmids contain a reporter gene (e.g., luciferase or GFP) that offers a readout of the activity...of interest could be inserted upstream of the luciferase gene to determine the level of transcription ...that promoter. Fluorescent Protein Plasmids , Luciferase Plasmids Viral Plasmids These plasmids are modified... -
Fluorescent Protein Guide
TypeCollection...at Addgene Addgene Blog: Fluorescent Proteins Luciferase Plasmid Collection Fluorescent Protein Kits Allen... -
Plasmid Collections
TypeCollection...Zinc Fingers Luminescence Fluorescent Proteins Luciferase Optogenetics Chemogenetics Viral Plasmids Lentivirus... -
Microbiology Resources
TypeCollection...Creating three-part fusion proteins - Planas and Santalucia Labs pCri System : Heterologous protein expression... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection...Use this AAV CRISPR knockout library expressing luciferase and Cre to interrogate tumorigenesis in vivo ...