Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 82 results for: LucY

Showing: 61 - 80 of 82 results

  1. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...expressing firefly luciferase. pCMV-FLuc - Retroviral reporter vector expressing firefly luciferase. pHAGE-CMV-Luc2... vector expressing firefly luciferase and ZsGreen. NL4-3 mCherry Luciferase - Lentiviral dual reporter...EGFP. Lenti-luciferase-P2A-Neo - Lentiviral reporter vector expressing firefly luciferase with neomycin...reporter vector expressing mCherry and firefly luciferase. pLentiEGFPdestablized - EFS-EGFPd2PEST-2A-MCS-Hygro...

  2. Zhang Lab CRISPR Page

    Type
    Collection
    ...to LacZ, plus luciferase-2A-Cre recombinase 60226 : sgRNA cloning backbone with luciferase-2A-Cre recombinase...sgRNAs targeting KRAS , p53 , and LKB1 , plus luciferase-2A-Cre recombinase, and Kras G12D HDR template...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and sgRNAs targeting the mouse...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and an sgRNA targeted to LacZ...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and an sgRNA backbone for ...

  4. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...James M. Wilson AV-1-PV0105 105532-AAV1 pAAV.CMV.ffLuciferase.SV40 Control James M. Wilson AV-1-PV1917 105541...James M. Wilson AV-8-PV0105 105532-AAV8 pAAV.CMV.ffLuciferase.SV40 Control James M. Wilson AV-8-PV0146 105535...Karl Deisseroth AV-5-PV0105 105532-AAV5 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-5-PV1090 105537-AAV5... M. Wilson AV-8-PV1302 105538-AAV8 pENN.AAV.TBG.PI.ffLuciferase.RBG James M. Wilson AV-8-PV3637 65015-...Karl Deisseroth AV-9-PV0105 105532-AAV9 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-9-PV0109 105533-AAV9...Karl Deisseroth AV-2-PV0105 105532-AAV2 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-1-PV3365 105554-AAV1...

  5. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...TALEN array for genomic engineering Luciferase Reporter See our Luciferase collection of plasmid backbones... to create a luciferase reporter Promoter Measure promoter strength pBV-Luc - Luciferase ...target genes can be inserted into this firefly luciferase reporter to test for their effects on protein...

  6. Bacterial Expression Systems

    Type
    Collection
    ...transcription factors. Addgene Blog Luciferase Technologies Enabled by NanoLuc® Luciferase Fluorescent Biosensors ...easily measurable reporter genes (e.g., LacZ, luciferase, or fluorescent proteins) under the control of...FFluc Promoter activity Luminescence (firefly luciferase) Mycobacterium sp. Brian Robertson , Siouxsie...

  7. Chemogenetics Plasmids

    Type
    Collection
    ...opto-chemogenetic actuator. When the luciferase enzyme oxidizes its substrate (luciferin), it generates light that...luminescent opsins: fusion proteins of a light-emitting luciferase and a light-sensing optogenetic element, making...

  8. Retrovirus Plasmids

    Type
    Collection
    ...18760 MSCV IRES Luciferase MSCV Plasmid for transgene expression; also expresses luciferase Lowe 9044 pMIG...Sun 60683 pLXIN-Luc MoMSV Stable expression of luciferase in mammalian cells Wong Return to Top Do you ...

  9. Control AAV Preps

    Type
    Collection
    ...Constitutive 5, 8 Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase Constitutive 8 Wilson 105534 ...

  10. COVID-19 Resources

    Type
    Collection
    ...Scientists have been working at lightning speed to elucidate as much as they can about this novel virus. It...spike pseudotyped virus. It also lists several luciferase and fluorescent reporter plasmids that have been...

  11. Chemogenetics Guide

    Type
    Guide
    ...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin) is ...efficiencies. Depending on the type of luciferase used, the luciferin substrate may be the native coelenterazine...is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite or inhibit...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference...

  12. Fluorescent Protein Guide

    Type
    Collection
    ... Resources You May Also Like... Luminescence: Luciferase Plasmids Blog: Which FP Should I Use? Blog: How...

  13. Plasmid Collections

    Type
    Collection
    ...Zinc Fingers Luminescence Fluorescent Proteins Luciferase Optogenetics Chemogenetics Viral Plasmids Lentivirus...

  14. Sequencing Primers

    Type
    Guide
    ...AGTCAAGTAACAACCGCGA 3' end of luciferase, forward primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer... primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...

  15. Microbiology Resources

    Type
    Collection
    ...Creating three-part fusion proteins - Planas and Santalucia Labs pCri System : Heterologous protein expression...

  19. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... MAPT T5, luciferase CMV Parkinson's, FTD Eugene Yeo 214673 lucMAPT-30U MAPT T5, luciferase CMV Parkinson's...FTD Eugene Yeo 214674 lucMAPT-GenRep MAPT T5, luciferase CMV Parkinson's, FTD Eugene Yeo 214814 U6_ ATM_G101...

  20. Molecular Biology Reference

    Type
    Guide
    ...plasmids contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the activity...of interest could be inserted upstream of the luciferase gene to determine the level of transcription ...
Showing: 61 - 80 of 82 results