Skip to main content

We narrowed to 5 results for: LucY

Showing: 1 - 5 of 5 results
  1. Chemogenetics Guide

    Type
    Guide
    ...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin) is ...efficiencies. Depending on the type of luciferase used, the luciferin substrate may be the native coelenterazine...is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite or inhibit...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome Reference LMO3 sbGLuc...
  2. Sequencing Primers

    Type
    Guide
    ...AGTCAAGTAACAACCGCGA 3' end of luciferase Forward LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase Reverse M13 Forward...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC 5' of ...
  3. Molecular Biology Reference

    Type
    Guide
    ...These plasmids contain a reporter gene (e.g., luciferase or GFP) that offers a readout of the activity...of interest could be inserted upstream of the luciferase gene to determine the level of transcription ...that promoter. Fluorescent Protein Plasmids , Luciferase Plasmids Viral Plasmids These plasmids are modified...
  4. Optogenetics Guide

    Type
    Guide
    ...-emitting luciferase fused to a light-sensing element such as an opsin. When the luciferase substrate ...substrate is added, the luciferase enzyme generates light that activates the opsin. While LMOs can also be activated...
  5. Guide to Using Pooled Libraries

    Type
    Guide
    ...permit reversible loss-of-function screening to elucidate which genes are involved in a phenotype. They ...
Showing: 1 - 5 of 5 results