Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 3 results for: LucY

Showing: 1 - 3 of 3 results

  1. Chemogenetics Guide

    Type
    Guide
    ...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin) is ...efficiencies. Depending on the type of luciferase used, the luciferin substrate may be the native coelenterazine...is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite or inhibit...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference...

  2. Sequencing Primers

    Type
    Guide
    ...AGTCAAGTAACAACCGCGA 3' end of luciferase, forward primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer... primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...

  3. Molecular Biology Reference

    Type
    Guide
    ...plasmids contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the activity...of interest could be inserted upstream of the luciferase gene to determine the level of transcription ...
Showing: 1 - 3 of 3 results