Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 105 results for: pcas

Showing: 61 - 80 of 105 results

  8. Typing CRISPR Systems

    Type
    Blog Post
    ...There are three subtypes, A–C, with the beloved SpCas9 (from Streptococcus pyogenes) belonging in II-A...

  11. Cre-lox system

    Type
    Collection
    ...Scholer 125574 pCAG-Cre Cre CAG Mammalian Imai 125577 pCAG-iCre iCre CAG Mammalian Imai 125748 pCAG-sfGFP-GSAx9...Cre Bacterial Rajewsky 13775 pCAG-Cre Cre-Myc CAG Mammalian Cepko 13776 pCAG-Cre:GFP Cre-GFP fusion CAG ...Lentiviral Fuchs 26646 pCAG-Cre-IRES2-GFP Cre and GFP coexpression CAG Mammalian Chenn 26647 pCAG-Cre Cre CAG Mammalian...51267 pCAG-Co-InCreN N-terminal component of the Co-InCre system CAG Mammalian Pelczar 51268 pCAG-Co-InCreC...69572 pCAG-N-CretrcintG Cre recombinase dependent on GFP (CRE-DOG) CAG Mammalian Cepko 69573 pCAG-C-CreintG...Pu 87694 pCAG-ERT2-PhoCl-Cre-PhoCl-ERT2 light-activated Cre cTnT Mammalian Campbell 89573 pCAG-iCre iCre...Mammalian Heller 112618 pCAG-VHC Venus, Cre-ERT2 CAG Mammalian Heller 112619 pCAG-EHC Emerald, Cre-ERT2 ...

  12. Zhang Lab CRISPR Page

    Type
    Collection
    ...efficiency. SpCas9 and SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A nickase...plasmid expressing SpCas9 alone without sgRNA. Full references are below. 1. SpCas9 (or SpCas9n, D10A nickase...expression cassettes, a human codon-optimized SpCas9 or SpCas9n, and the single guide RNA. The vector can ... 3. SpCas9 alone: This plasmid contains a single cassette expressing human codon-optimized SpCas9; sgRNA...codon-optimized SpCas9 plasmids can be ordered via the links below: 42230 : PX330; SpCas9 and single guide...guide RNA 48138 : PX458; SpCas9-2A-EGFP and single guide RNA 62988 : PX459; SpCas9-2A-Puro and single guide...RNA 48873 : PX460; SpCas9n (D10A nickase) and single guide RNA 48140 : PX461; SpCas9n-2A-EGFP (D10A nickase...

  13. CRISPR Guide

    Type
    Guide
    ...pyogenes (SP); SpCas9 3' NGG SpCas9 D1135E variant 3' NGG (reduced NAG binding) SpCas9 VRER variant 3'...NGCG SpCas9 EQR variant 3' NGAG SpCas9 VQR variant 3' NGAN or NGNG xCas9 3' NG, GAA, or GAT SpCas9-NG 3...engineered Cas9s can enhance CRISPR specificity. SpCas9 (from Streptococcus pyogenes ) is the most popular...no cuts. Cas9 nickase (Cas9n), a D10A mutant of SpCas9, has one active nuclease domain and one inactivated...fidelity enzymes, and their mechanisms, include: eSpCas9(1.1) - weaken interactions between the HNH/RuvC...RuvC groove and the non-target DNA strand SpCas9-HF1 - disrupt Cas9’s interactions with DNA phosphate backbone...your desired genes for modification. Engineered SpCas9 enzymes with altered PAM specificities are available...

  14. CRISPR Guide

    Type
    Collection
    ...pyogenes (SP); SpCas9 3' NGG SpCas9 D1135E variant 3' NGG (reduced NAG binding) SpCas9 VRER variant 3'...NGCG SpCas9 EQR variant 3' NGAG SpCas9 VQR variant 3' NGAN or NGNG xCas9 3' NG, GAA, or GAT SpCas9-NG 3...engineered Cas9s can enhance CRISPR specificity. SpCas9 (from Streptococcus pyogenes ) is the most popular...no cuts. Cas9 nickase (Cas9n), a D10A mutant of SpCas9, has one active nuclease domain and one inactivated...fidelity enzymes, and their mechanisms, include: eSpCas9(1.1) - weaken interactions between the HNH/RuvC...RuvC groove and the non-target DNA strand SpCas9-HF1 - disrupt Cas9’s interactions with DNA phosphate backbone...your desired genes for modification. Engineered SpCas9 enzymes with altered PAM specificities are available...

  15. CRISPR References and Information

    Type
    Collection
    ... donor design. The current version supports SpCas9, SpCas9-VQR, and enAsCas12a Cas enzymes. Developed ...Design DeepSpCas9 (Link opens in a new window) A webtool that uses deep learning models for SpCas9 gRNA ...pAc-sgRNA-Cas9 PDF, 169 KB Marraffini Bacteria: pCas9 new spacer cloning pCas9 PDF, 129 KB Marraffini Bacteria: pCRISPR...Musunuru CRISPRs in human pluripotent stem cells pCas9_GFP ; gRNA empty vector Protocol at StemBook O'Connor-Giles... for Genomic Deletions in Mammalian Cell Lines pSpCas9(BB) (pX330) Protocol at Addgene Parrott NEBuilder...

  16. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Mb Cpf1 Kim pCAG-SpCas9-GFP-U6-gRNA 79144 Mammalian hU6 yes, cut S. pyogenes EGFP Zou pCAG-eCas9-GFP-U6...Chimeric_BB-CBh-hSpCas9-hGem(1/110) 71707 Mammalian hU6 yes, cut S. pyogenes Draetta pCAS1yl 73226 Other/...BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...backbone 61424 Mammalian BbsI none S. pyogenes Zhang pSpCas9n(BB)-2A-Puro (PX462) V2.0 62987 Mammalian BbsI ...BbsI yes, nick S. pyogenes Puro Zhang pSpCas9(BB)-2A-Puro (PX459) V2.0 62988 Mammalian BbsI yes, cut S. pyogenes...Yeast RPR1(TetO) yes, cut S. pyogenes URA3 Davis eSpCas9(1.1) 71814 Mammalian U6 yes, cut (enhanced) S. ...

  17. TALEN Plasmids and Kits

    Type
    Collection
    ...Golden Gate TALEN 2.0 37184 pCAG-T7-TALEN(Sangamo)-Destination Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination...mutations) FokI domains. 40131 pCAG-T7-TALEN(Sangamo)-FokI-KKR-Destination 40132 pCAG-T7-TALEN(Sangamo)-FokI-...robust cleavage activity in several later studies. pCAG-T7-TALEN(Sangamo)-Destination vectors are available...assembly. Destination vectors, pcDNA-TAL-NC2 and pCAGGS-TAL-NC2, are mammalian expression/mRNA synthesis...

  18. Sequencing Primers

    Type
    Guide
    ...BamHI, reverse primer pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer... primer pCasper-F GGGTTTTATTAACTTACAT (Vosshall lab) 5' end of Drosophila mini-white gene, reverse primer...primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter, forward primer pcDL-F GTTGCCTTTACTTCTAGGCCT...

  19. Lentiviral Prep Service

    Type
    Collection
    ...-targeting controls. This backbone contains SpCas9. SpCas9 and 76,441 unique sgRNAs targeting 19,114 human...non-targeting controls. This backbone does not contain SpCas9. 76,441 unique sgRNAs targeting 19,114 human genes...non-targeting controls. This backbone does not contain SpCas9. 78,637 unique sgRNAs targeting 19,674 mouse genes...

  20. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...to dimerization pcDNA3-CFP - Mammalian Expression pCAG-CFP - Mammalian Expression Cerulean 433 475 27 4.7... dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian Expression pLV-eGFP - Mammalian ...530 68 5.9 Monomer pJL-mGold - Yeast Expression pCaggs-mGold - Mammalian Expression mCitrine 516 529 59... Mammalian Expression DsRed2 563 582 24 Tetramer pCAG-DsRed2 - Mammalian Expression DsRed2-N1 - Mammalian... - Mammalian Expression HcRed1 588 618 0.3 Dimer pCAG-HcRed - Mammalian Expression HcRed1-N1 - Mammalian...
Showing: 61 - 80 of 105 results