Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 73 results for: retroviral vectors

Showing: 61 - 73 of 73 results

  1. Lentiviral Vector Guide

    Type
    Guide
    ...Guides Viral Vectors Lentiviral Vector Guide Lentiviral Vector Guide Jump To: Lentiviral Vectors Lentiviral...Addgene's gamma-retroviral vector guide . Lentiviral Vectors The genome of lentiviruses typically ranges from... Answered The Retroviral Lifecycle More Viral Vectors 101 topics More Lentiviral Vector topics Addgene...lentiviral vectors that can be safely used in laboratory settings. These engineered lentiviral vectors have ...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a..., see Addgene’s viral vector protocols . Figure 5: Overview of lentiviral vector production. Created with...Lentiviral Vectors Due to their integration and long-term expression of a transgene, lentiviral vectors are ...

  2. Twenty Years of Sharing: Expanding Accessibility

    Type
    Blog Post
    ... CRISPRTwenty Years of Sharing: Addgene's Viral Vector Service...Lentiviral Guide AAV Guide Optogenetics Guide γ-Retrovirus Guide Protocols Agarose Gel Electrophoresis...

  3. Sequencing Primers

    Type
    Guide
    ...pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors, reverse... in pBABE vectors, forward primer pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli...TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector pBMN 5' GCTTGGATACACGCCGC...GCTTGGATACACGCCGC MMLV sequence, for inserts in pBMN retroviral vector pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin... in pcDL vector, forward primer pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector, forward ...attL2 in pENTR vector, reverse primer pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX vectors, reverse primer... Lab) Psi packaging signal, 5' of MCS in pBABE vectors, forward primer pGEX 5' GGGCTGGCAAGCCACGTTTGGTG...

  4. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Douglas Kim , GENIE Project Calcium Bicistronic vector expressing GCaMP6 and mRuby2 for imaging neural... Dual- and Triple-Feature Intersectional Single-Vector Delivery of Diverse Functional Payloads to Cells... Mitophagy Dual-emission mitophagy biosensor (retroviral expression of pH sensitive mt-mKeima) The ubiquitin...mitochondria"). ID Plasmid Description Gene/Insert Vector Type Eligible for Viral Packaging PI Return to ...

  5. Immunology Research Plasmids and Resources

    Type
    Collection
    ... open reading frames (ORFs) cloned into a retroviral vector which adds a myristoylation sequence and flag-epitope...CARMA1, MGC133069 CBL Cas-Br-M (murine) ecotropic retroviral transforming sequence C-CBL, CBL2, RNF55 CBLB...CBLB Cas-Br-M (murine) ecotropic retroviral transforming sequence b DKFZp686J10223, DKFZp779A0729, DKFZp779F1443...Nbla00127, RNF56 CBLC Cas-Br-M (murine) ecotropic retroviral transforming sequence c CBL-3, CBL-SL, RNF57 ...Reading Frames (ORFs) in pDONR-223 Gateway® Entry vectors from the labs of William Hahn and David Root . ...systems. The MXS-chaining kit includes chaining vectors with multiple cloning sites and standardized building...

  6. Molecular Biology Reference

    Type
    Guide
    ...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. If you are looking...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...specifically engineered plasmids, commonly referred to as vectors, which have become possibly the most ubiquitous...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a...expression (for the purposes of gene study). Expression vectors must contain a promoter sequence, a transcription...the transcription process to stop. An expression vector can also include an enhancer sequence which increases... amount of protein or RNA produced. Expression vectors can drive expression in various cell types (mammalian...

  7. Adenovirus Plasmids

    Type
    Collection
    ...Collection of adenovirus shuttle vectors and strains...Biosafety Lentiviral Plasmids AAV Plasmids Viral Vectors 101 eBook Adenoviruses are a class of medium-sized...100% efficiency. Unlike lentiviruses or other retroviruses , adenoviruses do not integrate into the host...

  8. Plasmid Collections

    Type
    Collection
    ...Proteins Protein Expression Synthetic Biology Viral Vectors Communities Find a scientific community that has...Plasmids Lentivirus Adeno-associated Virus (AAV) γ-Retrovirus Adenovirus All Viral Plasmids Curated Topics ...

  9. CRISPR Guide

    Type
    Collection
    ...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...

  10. Lentivirus Plasmids

    Type
    Collection
    ...Kasparov 1732 pCPRDEnv 2nd Packaging part of the FELIX vector system, expresses Gag-Pol and Rev Nolan 35617 pCAG-Eco... Transfer Plasmids Lentiviruses, a subset of retroviruses, are some of the most common and useful types...

  11. CRISPR Guide

    Type
    Guide
    ...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...

  12. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...237005 VCP-HaloTag Vector VCP Halo CMV ALS Promega Corporation 237006 HaloTag-VCP Vector VCP Halo CMV ALS...Plasmid Type Mammalian, non-viral Lentiviral AAV Retroviral Bacterial Yeast Other Promoter CMV T7 polH GAL...19 James Trimmer 129409 Slc1a3-CreERT2 Targeting Vector SLC1A3 PGK Episodic ataxia Walker Jackson 129410...ALS Promega Corporation 237148 NanoBRET Assay Vector, TREM2-HaloTag TREM2 Halo CMV Alzheimer's Promega ...Corporation 237172 EIF2AK2(252-551)-NanoLuc Fusion Vector EIF2AK2 NanoLuc CMV VWM disease Promega Corporation...

  13. Science Guides

    Type
    Guide
    ...Chemogenetics CRISPR Optogenetics Pooled Libraries Viral Vectors Antibodies Produced by the immune system, antibodies...restricted to certain gene sets. Read More Viral Vectors Find educational guides to learn more about the...Lentivirus Adeno-associated Virus (AAV) Adenovirus γ-Retrovirus Read More...
Showing: 61 - 73 of 73 results