We narrowed to 71 results for: retroviral vectors

... CRISPRTwenty Years of Sharing: Addgene's Viral Vector Service...Lentiviral Guide AAV Guide Optogenetics Guide γ-Retrovirus Guide Protocols Agarose Gel Electrophoresis...

...inserts in pBMN retroviral vector MMLV sequence, for inserts in pBMN retroviral vector Forward pBR322ori-F... 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD ...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1...Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...

... Dual- and Triple-Feature Intersectional Single-Vector Delivery of Diverse Functional Payloads to Cells... Mitophagy Dual-emission mitophagy biosensor (retroviral expression of pH sensitive mt-mKeima) The ubiquitin...mitochondria"). ID Plasmid Description Gene/Insert Vector Type Eligible for Viral Packaging PI Return to ...

...engineered into viral vectors for safe use in the lab. One safety feature of lentiviral vectors is that the components...plasmids available at Addgene. Read our Lentiviral Vector Guide for more information about lentiviral components... viral production, and viral safety. Lentiviral Vector Guide Popular Lentiviral Transfer Plasmids Looking...Description PI 1732 pCPRDEnv 2nd Part of the FELIX vector system. Expresses gag-pol and rev . Garry Nolan...Kasparov Return to top Additional Resources Lentiviral Vector Guide Addgene’s Viral Service Lentiviral Pooled...Pooled Libraries All Viral Plasmids Viral Vectors 101 eBook Biosafety Resource Guide Addgene blog: Tips for...Plasmids Resources Lentiviruses, a subset of retroviruses, are some of the most common and useful types...

... open reading frames (ORFs) cloned into a retroviral vector which adds a myristoylation sequence and flag-epitope...CARMA1, MGC133069 CBL Cas-Br-M (murine) ecotropic retroviral transforming sequence C-CBL, CBL2, RNF55 CBLB...CBLB Cas-Br-M (murine) ecotropic retroviral transforming sequence b DKFZp686J10223, DKFZp779A0729, DKFZp779F1443...Nbla00127, RNF56 CBLC Cas-Br-M (murine) ecotropic retroviral transforming sequence c CBL-3, CBL-SL, RNF57 ...Reading Frames (ORFs) in pDONR-223 Gateway® Entry vectors from the labs of William Hahn and David Root . ...systems. The MXS-chaining kit includes chaining vectors with multiple cloning sites and standardized building...

...Proteins Protein Expression Synthetic Biology Viral Vectors Communities Find a scientific community that has...Plasmids Lentivirus Adeno-associated Virus (AAV) γ-Retrovirus Adenovirus All Viral Plasmids Curated Topics ...

...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...

...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. Empty Backbones , ...another, such as from a chromosome to a plasmid or vector DNA backbone. These tools are essential to the ...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a...usually for the purposes of gene study. Expression vectors must contain a promoter sequence, a transcription... sequence, and the inserted gene. An expression vector can also include an enhancer sequence which increases... amount of protein or RNA produced. Expression vectors can drive expression in various cell types (mammalian...

...237005 VCP-HaloTag Vector VCP Halo CMV ALS Promega Corporation 237006 HaloTag-VCP Vector VCP Halo CMV ALS...HiBiT-TREM2 Vector TREM2 HiBiT CMV Alzheimer's Promega Corporation 238681 NanoLuc-TREM2 Vector TREM2 NanoLuc...HaloTag-TREM2 Vector TREM2 HaloTag CMV Alzheimer's Promega Corporation 238706 NanoBRET Assay Vector, CSF1R-NanoLuc...PINK1-SmBiT Vector PINK1 SmBiT CMV Parkinson's Promega Corporation 238783 PINK1-LgBiT Vector PINK1 LgBiT...LgBiT-TREM2 Vector TREM2 LgBiT CMV Alzheimer's Promega Corporation 238801 TREM2-SmBiT Vector TREM2 SmBiT...LgBiT Vector TREM2 LgBiT CMV Alzheimer's Promega Corporation 238850 EIF2AK2-NanoLuc Fusion Vector EIF2AK2...Plasmid Type Mammalian, non-viral Lentiviral AAV Retroviral Bacterial Yeast Other Promoter CMV T7 polH GAL...

...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...

...Chemogenetics CRISPR Optogenetics Pooled Libraries Viral Vectors Antibodies Produced by the immune system, antibodies...restricted to certain gene sets. Read More Viral Vectors Find educational guides to learn more about the...Lentivirus Adeno-associated Virus (AAV) Adenovirus γ-Retrovirus Read More...